白介素1β(IL1b)引物對(duì)
Primer Pair for Interleukin 1 Beta (IL1b)
IL1-B; IL1-Beta; IL1F2; IL-1β; Interleukin-1 Family Member 2; Catabolin
- 編號(hào)PGA563Bo02
- 物種Bos taurus; Bovine (Cattle,牛)相同的名稱,不同的物種。
- 適用片段Met1~Pro266
- 上游引物CGGAATTCATGGCAACCGTACCTGAACCC
- 下游引物CCGCTCGAGTTAGGGAGAGAGGGTTTCCATTC
- 純化方式RPC
- 酶切位點(diǎn)5'-EcoRI, 3'-XhoI
- 解鏈溫度55-60℃
- 性狀凍干粉
- 應(yīng)用PCR
- 下載英文說(shuō)明書(shū) 中文說(shuō)明書(shū)
- 規(guī)格1 OD
- 價(jià)格 ¥ 360
- 欲了解實(shí)際交易價(jià)格和更多情況,請(qǐng)與當(dāng)?shù)亟?jīng)銷商聯(lián)系!
用法
利用無(wú)菌水稀釋到10-100uM,可渦旋混勻。
儲(chǔ)存
避免反復(fù)凍融。2-8°C不超過(guò)一個(gè)月,-20°C不超過(guò)12個(gè)月。
贈(zèng)品
增值服務(wù)
相關(guān)產(chǎn)品
編號(hào) | 適用物種:Bos taurus; Bovine (Cattle,牛) | 應(yīng)用(僅供研究使用,不用于臨床診斷!) |
RPA563Bo02 | 白介素1β(IL1b)重組蛋白 | Positive Control; Immunogen; SDS-PAGE; WB. |
RPA563Bo01 | 白介素1β(IL1b)重組蛋白 | Positive Control; Immunogen; SDS-PAGE; WB. |
PAA563Bo02 | 白介素1β(IL1b)多克隆抗體 | WB; IHC; ICC; IP. |
PAA563Bo01 | 白介素1β(IL1b)多克隆抗體 | WB |
MAA563Bo21 | 白介素1β(IL1b)單克隆抗體 | WB; IHC; ICC; IP. |
SEA563Bo | 白介素1β(IL1b)檢測(cè)試劑盒(酶聯(lián)免疫吸附試驗(yàn)法) | Enzyme-linked immunosorbent assay for Antigen Detection. |
MEA563Bo | 白介素1β(IL1b)檢測(cè)試劑盒(酶聯(lián)免疫吸附試驗(yàn)法,小樣本) | Enzyme-linked immunosorbent assay for Antigen Detection. |
LMA563Bo | 白介素1β(IL1b)等多因子檢測(cè)試劑盒(流式熒光發(fā)光法) | FLIA Kit for Antigen Detection. |
KSA563Bo01 | 白介素1β(IL1b)檢測(cè)試劑盒DIY材料(酶聯(lián)免疫吸附試驗(yàn)法) | Main materials for "Do It (ELISA Kit) Yourself". |
PGA563Bo02 | 白介素1β(IL1b)引物對(duì) | PCR |
CGA563Bo02 | 白介素1β(IL1b)cDNA | PCR、蛋白表達(dá)等 |
參考文獻(xiàn)
雜志 | 參考文獻(xiàn) |
Respiration | Protective Effect of Nicotine on Lipopolysaccharide-Induced Acute Lung Injury in Mice[Karger: 000319151] |
Experimental Gerontology | Prophylactic lithium alleviates postoperative cognition impairment by phosphorylating hippocampal glycogen synthase kinase-3β (Ser9) in aged rats[ScienceDirect: S0531556511002373] |
New Zealand Veterinary Journal | Dominant expression of interleukin-8 vs interleukin-1β and tumour necrosis factor alpha in lungs of lambs experimentally infected with Mannheimia haemolytica.[Tandfonline: 596180] |
The Journal of Urology | Improvement by Phytotherapeutic Agent of Detrusor Overactivity, Down-Regulation of Pharmacological Receptors and Urinary Cytokines in Rats with Cyclophosphamide Induced Cystitis[PubMed: S0022534712049087] |
Journal of Periodontology Online | The Effect of Radachlorin-Mediated Antimicrobial Photodynamic Therapy on Clinical Parameters and Cytokine Profile in Ligature-Induced Periodontitis in Dogs[PubMed: 22813345] |
PLoS One | Recombinant Adiponectin Ameliorates Liver Ischemia Reperfusion Injury via Activating the AMPK/eNOS Pathway[PubMed: PMC3676360] |
Lower Urinary Tract Symptoms | Effects of Saw Palmetto Extract on Urodynamic Parameters, Bladder Muscarinic and Purinergic Receptors and Urinary Cytokines in Rats with Cyclophosphamide-Induced Cystitis[Onlinelibrary: luts.12015] |
PLoS ONE | A Combinatorial Relative Mass Value Evaluation of Endogenous Bioactive Proteins in Three-Dimensional Cultured Nucleus Pulposus Cells of Herniated Intervertebral Discs: Identification of Potential Target Proteins for Gene Therapeutic Approaches[Plosone: Source] |
Journal of natural remedies | Ixora coccinea down Regulate the Inflammation-Associated Prostaglandins (PGE-2), Nitric Oxide (NO) and Cytokines Production in LPS-Stimulated RAW 264.7 Macrophage[Jnronline: Source] |
The Veterinary Journal | Quantitative assessment of hsp70, IL-1β and TNF-α in the spinal cord of dogs with E40K SOD1-associated degenerative myelopathy[Pubmed: 24662024] |
British Journal of Nutrition | n-6: n-3 PUFA ratio is involved in regulating lipid metabolism and inflammation in pigs[Pubmed: 23947577] |
AGE | Estrogen deficiency does not decrease the in vitro osteogenic potential of rat adipose-derived mesenchymal stem cells[Pubmed: 24687841] |
Inflamm Res. | Intracranial injection of recombinant stromal-derived factor-1 alpha (SDF-1α) attenuates traumatic brain injury in rats.[Pubmed: 24352531] |
Journal of Clinical Periodontology | Experimental peri-implant mucositis at different implant surfaces.[Pubmed: 24521508] |
Physiological Research | Budesonide added to modified porcine surfactant Curosurf may additionally improve the lung functions in meconium aspiration syndrome.[Pubmed: 2432969] |
International immunopharmacology | Ruscogenin attenuates monocrotaline-induced pulmonary hypertension in rats[Pubmed: 23538027] |
Journal of Pharmaceutical Sciences and Pharmacology | Anti-inflammatory Effect of Euphorbia hirta Leaf Extract in Rats and Modulation of Inflammation-Associated Prostaglandins (PGE-2) and Nitric Oxide (NO) Expression in RAW264.7 Macrophage[Ingentaconnect: Source] |
Mediators of Inflammation | Protective Effects of Pretreatment with Oleanolic Acid in Rats in the Acute Phase of Hepatic Ischemia-Reperfusion Injury: Role of the PI3K/Akt Pathway[Hindawi: 451826] |
Journal of Periodontology | Effects of Photodynamic Therapy on the Clinical and Gingival Crevicular Fluid Inflammatory Biomarkers in Chronic Periodontitis: A Split-Mouth Randomized Clinical Trial[Joponline: 130464] |
Antimicrobial Agents and Chemotherapy | The antimicrobial peptide OH-CATH30 as a potential therapy for antibiotic-resistant Pseudomonas aeruginosa keratitis[Asm:Source] |
INTERNATIONAL JOURNAL OF MEDICINE AND MEDICAL RESEARCH | L-ARGININE, BUT NOT L-NAME PROTECTS AGAINST LIVER INJURY INDUCED BY EXPERIMENTAL ISCHEMIA-REPERFUSION[Tdmu:Source] |
Basic & Clinical Pharmacology & Toxicology | Treatment with Carnitine Enhances Bone Fracture Healing under Osteoporotic and/or Inflammatory Conditions[Wiley:Source] |
Evidence-Based Complementary and Alternative Medicine | Ginsenosides Rg1 from Panax ginseng: A Potential Therapy for Acute Liver Failure Patients?[Pubmed:Pmc4241314] |
36 | MRTF-A steers an epigenetic complex to activate endothelin-induced pro-inflammatory transcription in vascular smooth muscle cells[Pubmed:Pmc4176337] |
Cell Death Dis. | MicroRNA-30d regulates cardiomyocyte pyroptosis by directly targeting foxo3a in diabetic cardiomyopathy[Pubmed:Pmc4237254] |
Inflamm Res. | Intracranial injection of recombinant stromal-derived factor-1 alpha (SDF-1α) attenuates traumatic brain injury in rats[Pubmed:24352531] |
J Clin Periodontol. | Experimental peri‐implant mucositis at different implant surfaces[Pubmed:24521508] |
Inflammation | Effects of honokiol on sepsis-induced acute kidney injury in an experimental model of sepsis in rats[Pubmed:24531855] |
Antimicrob Agents Chemother. | Therapeutic potential of the antimicrobial peptide OH-CATH30 for antibiotic-resistant Pseudomonas aeruginosa keratitis[Pubmed:24637683] |
British Journal of Nutrition | Grape seed extract supplementation attenuates the heat stress-induced responses of jejunum epithelial cells in Simmental?×?Qinchuan steers[Pubmed:24846452] |
J Surg Res. | Valproic acid protects septic mice from renal injury by reducing the inflammatory response[Pubmed:24948542] |
Inflammation.? | Alpha-lipoic acid exerts anti-inflammatory effects on lipopolysaccharide-stimulated rat mesangial cells via inhibition of nuclear factor kappa B (NF-κB) signaling pathway.[Pubmed:24962643] |
Archives of Oral Biology | Hyperlipidemia causes changes in inflammatory responses to periodontal pathogen challenge: Implications in acute and chronic infections[Pubmed:24992577] |
Investigative ophthalmology & visual science | TSG-6 Protects Corneal Endothelium From Transcorneal Cryoinjury in Rabbits[Pubmed:25034606] |
Connective Tissue Research | Metabolic and cytoprotective effects of in vivo peri-patellar hyaluronic acid injections in cultured tenocytes[Pubmed:25333747] |
Oncotarget | Senescence of tumor cells induced by oxaliplatin increases the efficiency of a lipid A immunotherapy via the recruitment of neutrophils[Pubmed:25347345] |
Molecular Medicine Reports | GYY4137, a hydrogen sulfide?releasing molecule, inhibits the inflammatory response by suppressing the activation of nuclear factor?kappa B and mitogen?activated protein kinases in Coxsackie virus B3?infected rat cardiomyocytes.[Pubmed:25377925] |
Neural Regen Res.? | Inflammatory response and neuronal necrosis in rats with cerebral ischemia[Pubmed:25422636] |
International Immunopharmacology | NF-κB activation and proinflammatory cytokines mediated protective effect of Indigofera caerulea Roxb. on CCl 4 induced liver damage in rats[Pubmed:25445959] |
Journal of Surgical Research | Ursolic acid improves survival and attenuates lung injury in septic rats induced by cecal ligation and puncture[Pubmed:25454976] |
Journal of Surgical Research | Melatonin attenuates intestinal ischemia–reperfusion-induced lung injury in rats by upregulating N-myc downstream-regulated gene 2[Pubmed:25491174] |
Journal of Translational Medicine | Protective effects of astaxanthin against ischemia/reperfusion induced renal injury in mice[Pubmed:25623758] |
Molecular Medicine Reports | Tanshinone ⅡA attenuates bleomycin-induced pulmonary fibrosis in rats[Pubmed:25672255] |
International Journal of Clinical and Experimental Pathology | Panax notoginseng saponins promote wound repair of anterior cruciate ligament through phosphorylation of PI3K, AKT and ERK[Pubmed:25755732] |
Mediators of Inflammation | Effect of TLR4/MyD88 Signaling Pathway on Expression of IL-1β and TNF-α in Synovial Fibroblasts from Temporomandibular Joint Exposed to Lipopolysaccharide[Pubmed:25810567] |
Int J Clin Exp Pathol | Rosiglitazone attenuates renal injury caused by hyperlipidemic pancreatitis[PubMed: 26191125] |
Clinical and Experimental Pharmacology and Physiology | Curcumin alleviates lung injury in diabetic rats by inhibiting nuclear factor‐κB pathway[PubMed: 26111829] |
Drug Des Devel Ther | Cardioprotection against ischemia/reperfusion injury by QiShenYiQi Pill[PubMed: 26109848] |
Endocrine Journal | Relationship between serum secreted frizzled-related protein 4 levels and the first-phase of glucose-stimulated insulin secretion in individuals with different glucose tolerance[PubMed: 26041556] |
Int J Clin Exp Pathol | Effects of dexmedetomidine on the protection of hyperoxia-induced lung injury in newborn rats[PubMed: 26261523] |
Biomed Res Int | Basic Fibroblast Growth Factor Ameliorates Endothelial Dysfunction in Radiation-Induced Bladder Injury[PubMed: 26351640] |
Front Pharmacol | Glycyrrhizic acid alleviates bleomycin-induced pulmonary fibrosis in rats[PubMed: 26483688] |
Mol Med Rep | Roles of lipoxin A4 receptor activation and anti-interleukin-1β antibody on the toll-like receptor 2/mycloid differentiation factor 88/nuclear factor-κB pathway in airway inflammation induced by ovalbumin[PubMed: 25760938] |
Life Sci | Betulin attenuates kidney injury in septic rats through inhibiting TLR4/NF-κB signaling pathway[PubMed: 26656467] |
Asian Pac J Trop Med | Effect of SecinH3 on lung injury induced by sepsis of rats[PubMed: 26706678] |
PLOS ONE | Penehyclidine Hydrochloride Preconditioning Provides Cardioprotection in a Rat Model of Myocardial Ischemia/Reperfusion Injury[PubMed: 26632817] |
Int Immunopharmacol | Betulin attenuates lung and liver injuries in sepsis[PubMed: 26644168] |
Journal of Histochmistry and Cytochmistry | Epigallocatechin-3-Gallate Attenuates Unilateral Ureteral Obstruction-Induced Renal Interstitial Fibrosis in Mice[PubMed: 25549657] |
J Histochem Cytochem | Glycyrrhizic Acid Prevents Sepsis-Induced Acute Lung Injury and Mortality in Rats[PubMed: 26385569] |
Anim Reprod Sci. | Alteration in peripheral blood concentration of certain pro-inflammatory cytokines in cows developing retention of fetal membranes[PubMed: 25851495] |
Cell Physiol Biochem | MicroRNA-155 Promotes Atherosclerosis Inflammation via Targeting SOCS1[PubMed: 26159489] |
Journal of Medicinal Food | A Standardized Extract of[PubMed: 26501382] |
journal of veterinary science | Autologous processed plasma: cytokine profile and effects upon injection into healthy equine joints[PubMed: 25269714] |
Clin Exp Pharmacol Physiol | Silymarin attenuates paraquat-induced lung injury via Nrf2-mediated pathway in vivo and in vitro[PubMed: 26173462] |
Immunologic Research | Mesenchymal stromal cell-dependent reprogramming of Kupffer cells is mediated by TNF-α and PGE2 and is crucial for liver transplant tolerance[PubMed: 25982496] |
Journal of Surgical Research | Cyanidin-3-O-glucoside attenuates acute lung injury in sepsis rats[PubMed: 26152793] |
Life Sciences | Neuroprotective effect of allicin in a rat model of acute spinal cord injury[PubMed: 26546416] |
International Journal of Immunopathology & Pharmacology | Sea buckthorn (Hippophae rhamnoides L.) oil protects against chronic stress-induced inhibitory function of natural killer cells in rats[PubMed: 26684638] |
Arquivos Brasileiros de Oftalmologia | Effects of morphine on the expression of cytokines and inflammatory mediators in a rabbit model of endotoxin-induced experimental uveitis[PubMed: 26677041] |
Neuropeptides | Melanocortin MC6 receptor agonists alleviate brain damage in abdominal compartment syndrome in the rat[PubMed: 25616531] |
The American Journal of Sports Medicine | Differential Interactive Effects of Cartilage Traumatization and Blood Exposure In Vitro and In Vivo[PubMed: 26362437] |
MEDICAL SCIENCES | ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ЭФФЕКТИВНОСТИ РАЗНЫХ МЕТОДОВ СТИМУЛЯЦИИ РЕПАРАТИВНОГО ОСТЕОГЕНЕЗА В ЭКСПЕРИМЕНТЕ[Article: N] |
Медицина и здравоохранение | ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ЭФФЕКТИВНОСТИ РАЗНЫХ МЕТОДОВ СТИМУЛЯЦИИ РЕПАРАТИВНОГО ОСТЕОГЕНЕЗА В ЭКСПЕРИМЕНТЕ[Article: N] |
Journal of Equine Veterinary Science | Synovial Fluid and Serum Concentrations of Interleukin-1 Receptor Antagonist and Interleukin-2[Science: Article] |
Mediators Inflamm | Effect of TLR4/MyD88 Signaling Pathway on Expression of IL-1 and TNF-in Synovial Fibroblasts from Temporomandibular Joint Exposed to Lipopolysaccharide[PubMed: 25810567] |
J Reprod Immunol | The immunomodulating effect of seminal plasma on T cells[PubMed: 25799173] |
J Thorac Cardiovasc Surg | Annexin V homodimer protects against ischemia reperfusion–induced acute lung injury in lung transplantation[PubMed: 26725713] |
J Breath Res | Effects of different ventilation strategies on exhaled nitric oxide in geriatric abdominal surgery[PubMed: 25719610] |
PLoS One | Low Shear Stress Induced HMGB1 Translocation and Release via PECAM-1/PARP-3 Pathway to Induce Inflammation Response[PubMed: 25793986] |
Fertil Steril | Inflammosome in the human endometrium: further step in the evaluation of the “maternal side”[PubMed: 26474737] |
J Biol Chem | The Blockade of NF-κB Activation by a Specific Inhibitory Peptide has a Strong Neuroprotective Role in a Sprague-Dawley Rat Kernicterus Model[PubMed: 26499797] |
J Vet Sci | Autologous processed plasma: cytokine profile and effects upon injection into healthy equine joints.[PubMed: 25269714] |
Mol Med Rep | Ameliorative effects of Gualou Guizhi decoction on inflammation in focal cerebral ischemic-reperfusion injury[PubMed: 25815894] |
J Interferon Cytokine Res | Aggregatibacter actinomycetemcomitans Invasion Induces Interleukin-1β Production Through Reactive Oxygen Species and Cathepsin B[PubMed: 25789553] |
удк | Циток[Cgi-Bin: Irbis_Nbuv] |
中華臨床醫(yī)生雜志 | 中性粒細(xì)胞明膠酶相關(guān)脂質(zhì)運(yùn)載蛋白對(duì)腹膜透析相關(guān)性腹膜炎療效監(jiān)測(cè)的意義[Journal: Fulltext] |
ANP | Oral PTCTS (Particulated Transialidase) Removes Serum Microparticles and Decreases Inflammation in Atherosclerotic Plaques of Rabbits[Journal: 60965] |
Immunol Res | Construction of recombinant Mip-FlaA dominant epitope vaccine against Legionella pneumophila and evaluation of the immunogenicity and protective immunity[PubMed: 26607265] |
The Journal of Nutritional Biochemistry | Protective role of n6/n3 PUFA supplementation with varying DHA/EPA ratios against atherosclerosis in mice[Pubmed:27142749] |
Infaction and Immunity | Biological Activities of Uric Acid in Infection Due to Enteropathogenic and Shiga-Toxigenic Escherichia coli[Pubmed:26787720] |
Scientific Reports | Cellular uptake of exogenous calcineurin B is dependent on TLR4/MD2/CD14 complexes, and CnB is an endogenous ligand of TLR4[Pubmed:27090571] |
Journal of Translational Medicine | Modulation of the sympathetic nervous system by renal denervation prevents reduction of aortic distensibility in atherosclerosis prone ApoE-deficient rats[Pubmed:27277003] |
Genetics and Molecular Research | Effect of ozone on vascular endothelial growth factor (VEGF) and related inflammatory cytokines in rats with diabetic retinopathy[Pubmed:27323014] |
Journal of Equine Veterinary Science | Interleukin-1 Receptor Antagonist and Interleukin-1 Beta Levels in Equine Synovial Fluid of Normal and Osteoarthritic Joints: Influence of Anatomic Joint Location and Repeated Arthrocentesis[science:S0737080615300757] |
Chinese Chemical Letters | Screening the anti-gout traditional herbs from TCM using an in vitro method[science:S1001841716301450] |
Front Microbiol | Innate Immune Responses in ALV-J Infected Chicks and Chickens with Hemangioma In Vivo[Pubmed:27252695] |
PLoS One. | Molecular Mechanisms Responsible for Neuron-Derived Conditioned Medium (NCM)-Mediated Protection of Ischemic Brain[Pubmed:26745377] |
Neuroscience | The inhibition of transforming growth factor beta-activated kinase 1 contributed to neuroprotection via inflammatory reaction in pilocarpine-induced rats with epilepsy[Pubmed:27012613] |
Neuroscience | Bexarotene protects against traumatic brain injury in mice partially through apolipoprotein E[Pubmed:27235741] |
Research in Veterinary Science | A chimeric protein composed of the binding domains ofClostridium perfringens?phospholipase C and?Trueperella pyogenes?pyolysin induces partial immunoprotection in a mouse model[Pubmed:27473983] |
SpringerPlus | Ethyl pyruvate?attenuated?coxsackievirus?B3-induced?acute?viral?myocarditis?by?suppression?ofHMGB1/RAGE/NF-ΚB?pathway.[Pubmed:27026909] |
The Journal of Thoracic and Cardiovascular Surgery | Annexin V homodimer protects against ischemia reperfusiona??induced acute lung injury in lung transplantation[Pubmed:26725713] |
International Immunopharmacology | Consistency and pathophysiological characterization of a rat polymicrobial sepsis model via the improved cecal ligation and puncture surgery[Pubmed:26802602] |
J Stroke Cerebrovasc Dis. | Curcumin Attenuates Inflammation, Oxidative Stress, and Ultrastructural Damage Induced by Spinal Cord Ischemia–Reperfusion Injury in Rats[Pubmed:26935117] |
Scientific publications in peer reviewed journals | Evidence-based review of efficacy and adverse effects of joint medication and evaluation of synovial fluid and serum markers for osteoarthritis in the horse[receive:101658] |
Asian Pacific Journal of Tropical Medicine | Perfusion of gastrodin in abdominal aorta for alleviating spinal cord ischemia reperfusion injury[science:S1995764516300955] |
Life Sci. | Carcinoembryonic antigen related cellular adhesion molecule 1 alleviates dextran sulfate sodium-induced ulcerative colitis in mice[Pubmed:26898127] |
Biol Trace Elem Res. | Analysis of Ionomic Profiles of Canine Hairs Exposed to Lipopolysaccharide (LPS)-Induced Stress[Pubmed:26758868] |
Basic Clin Pharmacol Toxicol | Neuroprotective Effect of Ginsenoside Rd in Spinal Cord Injury Rats[Pubmed:26833867] |
Virol J | Classical swine fever virus NS5A protein changed inflammatory cytokine secretion in porcine alveolar macrophages by inhibiting the NF-κB signaling pathway[Pubmed:27296632] |
Int J Mol Sci. | Dexmedetomidine Protects Rat Liver against Ischemia-Reperfusion Injury Partly by the α2A-Adrenoceptor Subtype and the Mechanism Is Associated with the TLR4/NF-κB Pathway[Pubmed:27347929] |
Journal of Neuroinflammation | Upregulation of neuronal zinc finger protein A20 expression is required for electroacupuncture to attenuate the cerebral inflammatory injury mediated by the nuclear factor-kB signaling pathway in cerebral ischemia/reperfusion rats[pubmed:27716383] |
Journal of Agricultural Biotechnology | Gln Attenuates LPS-induced Inflammatory Injury of Bos taurus Testis Sustentacular Cells[10610] |
Front Pharmacol | Poria Attenuates Idiosyncratic Liver Injury Induced by Polygoni Multiflori Radix Praeparata[pubmed:27803670] |
Journal of Equine Veterinary Science | Evaluation of Two Protocols Using Autologous Conditioned Serum for Intra-articular Therapy of Equine Osteoarthritis—A Pilot Study Monitoring Cytokines and Cartilage-Specific Biomarkers[S0737080616303720] |
immunology letters | Recombinant Mip-PilE-FlaA dominant epitopes vaccine candidate against Legionella pneumophila.[pubmed:28366526] |
Lipids in Health and Disease | Protective effects of various ratios of DHA/EPA supplementation on high-fat diet-induced liver damage in mice.[pubmed:28356106] |
biomedicine & pharmacotherapy | Diosgenin ameliorates development of neuropathic pain in diabetic rats: Involvement of oxidative stress and inflammation.[pubmed:28033582] |
International Journal of Molecular Medicine | The neutrophil elastase inhibitor, sivelestat, attenuates sepsis-related kidney injury in rats[pubmed:27430552] |
Springerplus | Ethyl pyruvate attenuated coxsackievirus B3-induced acute viral myocarditis by suppression of HMGB1/RAGE/NF-ΚB pathway[pubmed:27026909] |
Andrology | Chronic prostatitis/chronic pelvic pain syndrome impairs erectile function through increased endothelial dysfunction, oxidative stress, apoptosis, and corporal fibrosis …[doi:10.1111] |
Molecular?Immunology | Targeted inhibition of GATA-6 attenuates airway inflammation and remodeling by regulating caveolin-1 through TLR2/MyD88/NF-κB in murine model of asthma[pubmed:27289030] |
Cellular?Physiology and?Biochemistry | The?Neuroprotective Effect?of?Puerarin?in?Acute?Spinal Cord Injury?Rats.[pubmed:27576607] |
Physiological Research | Intravenous dexamethasone attenuated inflammation and influenced apoptosis of lung cells in an experimental model of acute lung injury.[pubmed:28006948] |
World?Journal of Gastroenterology? | Alterations in gut microbiota during remission and recurrence of diabetes after duodenal-jejunal bypass in rats[pubmed:27547013] |
Journal of Orthopaedic?Surgery?and?Research? | No midterm advantages in the middle term using small intestinal submucosa and human amniotic membrane in Achilles tendon transverse tenotomy[pubmed:27881176] |
Molecular Medicine Reports | C?reactive protein/oxidized low density lipoprotein/β2?glycoprotein i complexes induce lipid accumulation and inflammatory reaction in macrophages via p38/mitogen? …[10.3892] |
Poultry?Science | ALV-J strain SCAU-HN06 induces innate immune responses in chicken primary monocyte-derived macrophages[pubmed:27486255] |
Molecular?Medicine?Reports | Zisheng Shenqi decoction ameliorates monosodium urate crystal-induced gouty arthritis in rats through anti-inflammatory and anti-oxidative effects[pubmed:27432278] |
International Journal of Molecular?Sciences | PEDF Inhibits the Activation of NLRP3 Inflammasome in Hypoxia Cardiomyocytes through PEDF Receptor/Phospholipase A2[pubmed:27973457] |
The?American?Journal?of?Chinese?Medicine | Pinellia?ternata?Attenuates?Mucus?Secretion?and?Airway?Inflammation?after?InhaledCorticosteroid?Withdrawal?in?COPD?Rats.[pubmed:27430907] |
The Journal of Comenius University in Bratislava | Effects of Conventional Mechanical Ventilation Performed by Two Neonatal Ventilators on the Lung Functions of Rabbits with Meconium-Induced Acute Lung Injury[acm.2017.16.issue-3] |
Journal of Physiology and Pharmacology | Effects?of?budesonide?on the?lung?functions,?inflammation?and?apoptosis?in a?saline-lavagemodel?of?acute?lung?injury.[pubmed:28195073] |
Cellular?Physiology?and?Biochemistry | MiR-155?is?Involved?in?Renal?Ischemia-Reperfusion?Injury?via?Direct?Targeting?of?FoxO3a?andRegulating?Renal?Tubular?Cell?Pyroptosis.[pubmed:28006785] |
Oncotarget | Poly(ADP-ribose)?polymerase?1?inhibition?protects?cardiomyocytes?from?inflammation?andapoptosis?in?diabetic?cardiomyopathy.[pubmed:27027354] |
Life?Sciences | Bone fracture healing is delayed in splenectomic rats[pubmed:27956350] |
Sci Total Environ. | The?effects?of?particulate matter?on?inflammation?of?respiratory system:?Differences?betweenmale?and?female.[pubmed:28174048] |
Food Funct. | Flavonoids from sea buckthorn inhibit the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages through the MAPK and NF-κB pathways.[pubmed:28256654] |
PLoS One. | Self-complementary adeno-associated virus serotype 6 mediated knockdown of ADAMTS4 induces long-term and effective enhancement of aggrecan in degenerative human nucleus pulposus cells: A new therapeutic approach for intervertebral disc disorders.[pubmed:28207788] |
Cell Death Dis. | Salusin-β contributes to oxidative stress and inflammation in diabetic cardiomyopathy[pubmed:28333148] |
Journal of Photochemistry and Photobiology B: Biology | Efficacy of scaling and root planning with and without adjunct Nd:YAG laser therapy on clinical periodontal parameters and gingival crevicular fluid interleukin 1-beta and tumor necrosis factor-alpha levels among patients with periodontal disease: A prospective randomized split-mouth clinical study.[pubmed:28282558] |
Journal of Cellular Physiology | Autophagy maintains the integrity of endothelial barrier in LPS-induced lung injury.[pubmed:28328069] |
Biomedicine & pharmacotherapy= Biomedecine & pharmacotherapie | Protective effects of N-acetylcystein and atorvastatin against renal and hepatic injury in a rat model of intestinal ischemia-reperfusion[pubmed:28273631] |
Journal of Neurochemistry | β‐Caryophyllene protects in vitro neurovascular unit against oxygen‐glucose deprivation and re‐oxygenation‐induced injury[pubmed:27565895] |
Procalcitonin und proinflammatorische Zytokine in der bronchoalveol?ren Lavage beim lungenkranken Pferd unter inhalativer Glukokortikoidtherapie[FUDISS_thesis_000000103830] | |
Journal of Agricultural and Food Chemistry | Effect of boron on thymic cytokine expression, hormone secretion, antioxidant functions, cell proliferation, and apoptosis potential via the ERK1/2 signaling pathway[pubmed:29032684] |
PHYSIOLOGICAL RESEARCH | Selective Inhibition of NF-κB and Surfactant Therapy in Experimental Meconium-Induced Lung Injury[pubmed:28937237] |
MOLECULAR MEDICINE REPORTS | The effect of anagliptin on intimal hyperplasia of rat carotid artery after balloon injury[pubmed:28990108] |
Iranian Journal of Basic Medical Sciences | Naringin attenuates diabetic retinopathy by inhibiting inflammation, oxidative stress and NF-κB activation in vivo and in vitro[pubmed:28852447] |
Journal of Cellular Physiology | Increased Chondrogenic Potential of Mesenchymal Cells From Adipose Tissue Versus Bone Marrow‐Derived Cells in Osteoarthritic In Vitro Models[pubmed:27739057] |
Oral Diseases | Glucosamine oral administration as an adjunct to hyaluronic acid injection in treating temporomandibular joint osteoarthritis[pubmed:28862770] |
Biomedicine & Pharmacotherapy | Cytokine production in vitro and in rat model of colitis in response to Lactobacillus plantarum LS/07[pubmed:28830068] |
Food & Function | Flavonoids from sea buckthorn inhibit the lipopolysaccharide-induced inflammatory response in RAW264. 7 macrophages through the MAPK and NF-κB …[DOI:10.1039/C6FO01873D] |
cellular?physiology and biochemistry | Hydrogen-Rich Saline Attenuates Brain Injury Induced by Cardiopulmonary Bypass and Inhibits Microvascular Endothelial Cell Apoptosis Via the PI3K/Akt/GSK3β …[pubmed:29040978] |
Microbial Immunology | Immunomodulatory Activities of a Fungal Protein Extracted from Hericium erinaceus through Regulating the Gut Microbiota[pubmed:28713364] |
Pesquisa Veterinária Brasileira | Efeito protetor do β-glucano e glutamina em les?es intestinais e imunológicas induzidas por ciratabina (Ara-C) em camundongos[10.159:s0100-736x2017000900013] |
Evidence-Based Complementary and Alternative Medicine | BuShenKangShuai tablet reduces atherosclerotic lesion by improving blood lipids metabolism and inhibiting inflammatory response via TLR4 and NF-κB signaling pathway[journals:1758383] |
Frontiers in Neurology | a-Asarone Attenuates Cognitive Deficit in a Pilocarpine-Induced Status Epilepticus Rat Model via a Decrease in the Nuclear Factor-觀B Activation and Reduction in Microglia Neuroinflammation.[pubmed:29312110] |
中國(guó)免疫學(xué)雜志 | b-caryophyllene mitigates cerebral ischemia reperfusion injury in mice by inhibiting HMGB1/ TLR4/ NFkB pathway[doi:10. 3969 / j. issn. 1000-484X. 2017. 07. 011] |
Chinese Journal of comparative medicine (中國(guó)比較醫(yī)學(xué)雜志) | 富氫液通過(guò)P13K通路減輕大鼠腦缺血再灌注損傷[doi:10u3969.j.issn.1671-7856] |
PLoS One | Self-complementary adeno-associated virus serotype 6 mediated knockdown of ADAMTS4 induces long-term and effective enhancement of aggrecan in degenerative human nucleus pulposus cells: A new therapeutic approach for intervertebral disc disorders[10.1371:journal.pone.0172181] |
Experimentelle periimplant?re Mukositis an unterschiedlichen Implantatoberfl?chen[doi: 10.1111/jcpe.12240.] | |
International Journal of Biological Macromolecules | Chemical composition of Cyclocarya paliurus polysaccharide and inflammatory effects in lipopolysaccharide-stimulated RAW264.7 macrophage[pubmed:29032210] |
Journal of Photochemistry and Photobiology B: Biology | Efficacy of scaling and root planning with and without adjunct Nd:YAG laser therapy on clinical periodontal parameters and gingival crevicular fluid interleukin 1-beta and tumor necrosis factor-alpha levels among patients with periodontal disease: A prospective randomized split-mouth clinical study[10.1016/j.jphotobiol.2017.03.001] |
Frontiers in Neuroscience | Neuroprotective Effect of β-Caryophyllene on Cerebral Ischemia-Reperfusion Injury via Regulation of Necroptotic Neuronal Death and Inflammation: In Vivo and in Vitro[PMC5662640] |
International Journal of?Clinical?and Experimental Pathology | Platelet-derived growth factor and stromal cell-derived factor-1 promote the skin wound repairing effect of bone mesenchymal stem cells: a key role of matrix metalloproteinase 1 and collagens[ISSN:1936-2625/IJCEP0058424] |
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE | Ginsenoside Rg1 inhibits inflammatory responses via modulation of the nuclear factor?κB pathway and inhibition of inflammasome activation in alcoholic hepatitis[pubmed:29207044] |
Cellular Physiology and Biochemistry | Dexmedetomidine Alleviates HyperoxiaInduced Acute Lung Injury via Inhibiting NLRP3 Inflammasome Activation[pubmed:28873369] |
Tropical Journal of Pharmaceutical Research | Protective effect of salvianolic acid B against intestinal ischemia reperfusion-induced injury in a rat model[10.4314/tjpr.v16i10.17] |
Frontiers in Molecular Neuroscience | Electroacupuncture Suppresses the NF-κB Signaling Pathway by Upregulating Cylindromatosis to Alleviate Inflammatory Injury in Cerebral Ischemia/Reperfusion Rats[10.3389/fnmol.2017.00363] |
Scientific Reports | Optimization of Storage Temperature for Retention of Undifferentiated Cell Character of Cultured Human Epidermal Cell Sheets[pubmed:28811665] |
Oncotarget | Neuroprotection of Botch in experimental intracerebral hemorrhage in rats.[pubmed:29221132] |
PLoS One | Protective effect of aplysin on liver tissue and the gut microbiota in alcohol-fed rats[pubmed:28622357] |
Autonomic Neuroscience | Altered gastrointestinal motility in an animal model of Lesch-Nyhan disease.[pubmed:29305058] |
Endocrine, Metabolic & Immune Disorders-Drug Targets | Changes in Serum Nampt Levels and Its Significances in Diabetic Nephropathy Patients-The Potential Role of Nampt in T2DM with Diabetic Nephropathy.[pubmed:28699485] |
Biological Rhythm Research | A study of altered cytokine rhythms associated with successful implantation in cows[10.1080/09291016.2017.1361159] |
Biomedical and Environmental Sciences | Grape Seed Procyanidin Extract Reduces Arsenic-Induced Renal Inflammatory Injury in Male Mice.[pubmed:28756814] |
Acta Pharmacologica Sinica | Cis-stilbene glucoside in Polygonum multiflorum induces immunological idiosyncratic hepatotoxicity in LPS-treated rats by suppressing PPAR-γ.[pubmed:28649126] |
International journal of molecular medicine | Stromal-epithelial lactate shuttle induced by tumor?derived interleukin?1β promotes cell proliferation in oral squamous cell carcinoma[pubmed:29207019] |
Molecular Medicine Reports | Mild hypothermia pretreatment protects against liver ischemia reperfusion injury via the PI3K/AKT/FOXO3a pathway[pubmed:28944825] |
Veterinary microbiology | Secondary Haemophilus parasuis infection enhances highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) infection-mediated inflammatory responses.[pubmed:28532803] |
Biomedicine & pharmacotherapy | Berberine ameliorates intrahippocampal kainate-induced status epilepticus and consequent epileptogenic process in the rat: Underlying mechanisms[pubmed:28061403] |
International immunopharmacology | Low-dose SKA Progesterone and Interleukin-10 modulate the inflammatory pathway in endometriotic cell lines[pubmed:29272819] |
International immunopharmacology | Chronic dexamethasone treatment results in hippocampal neurons injury due to activate NLRP1 inflammasome in vitro[pubmed:28605710] |
Journal of Neuroinflammation | Chronic glucocorticoid exposure activates BK-NLRP1 signal involving in hippocampal neuron damage.[pubmed:28732502] |
Journal of Ethnopharmacology | Corydalis hendersonii Hemsl. protects against myocardial injury by attenuating inflammation and fibrosis via NF-κB and JAK2-STAT3 signaling pathways.[pubmed:28629818] |
Journal of Animal Science and Biotechnology | Plasma and cerebrospinal fluid interleukin-1β during lipopolysaccharide-induced systemic inflammation in ewes implanted or not with slow-release melatonin.[pubmed:29026538] |
Translational?Stroke?Research | Early Inflammatory Response in the Brain and Anesthesia Recovery Time Evaluation After Experimental Subarachnoid Hemorrhage[Pubmed:29926382] |
Journal?of?Controlled?Release | Nose-to-brain delivery of insulin enhanced by a nanogel carrier[Pubmed:29196041] |
PLOS?Pathogens | Cathepsin B aggravates coxsackievirus B3-induced myocarditis through activating the inflammasome and promoting pyroptosis[Pubmed:29360865] |
Cell?Death?&?Disease | AMP-activated protein kinase agonist N 6-(3-hydroxyphenyl) adenosine protects against fulminant hepatitis by suppressing inflammation and apoptosis[Articles:s41419-017-0118-0] |
Journal of?Neuroinflammation | Unconjugated bilirubin induces pyroptosis in cultured rat cortical astrocytes[Pubmed:29357878] |
Molecular Neurobiology | Neuroprotective Effects of Filgrastim in Rotenone-Induced Parkinson's Disease in Rats: Insights into its Anti-Inflammatory, Neurotrophic, and Antiapoptotic Effects[s12035-017-0855-1] |
Neuropharmacology | Levo-corydalmine alleviates vincristine-induced neuropathic pain in mice by inhibiting an NF-kappa B-dependent CXCL1/CXCR2 signaling pathway[Pubmed:29518397] |
Journal of Translational Medicine | Recurrent pregnancy loss is associated to leaky gut: a novel pathogenic model of endometrium inflammation?[Pubmed:29665864] |
Scientific Reports | Mesenchymal stromal cells inhibit NLRP3 inflammasome activation in a model of Coxsackievirus B3-induced inflammatory cardiomyopathy[Pubmed:29434214] |
American Journal of Physiology-Lung?Cellular?and Molecular Physiology | Maternal PUFA omega-3 supplementation prevents hyperoxia-induced pulmonary hypertension in the offspring[Pubmed:29597832] |
Food and Chemical Toxicology | Antioxidant, anti-inflammatory and synergistic anti-hyperglycemic effects of Malaysian propolis and metformin in streptozotocin–induced diabetic rats[Pubmed:30026088] |
International Journal of Biological Macromolecules | Alcohol accumulation promotes esophagitis via pyroptosis activation[Pubmed:30123073] |
Annals?of?Intensive?Care | Hypothermic total liquid ventilation after experimental aspiration-associated acute respiratory distress syndrome[Pubmed:29721820] |
British journal of nutrition | Phytic acid improves intestinal mucosal barrier damage and reduces serum levels of proinflammatory cytokines in a 1, 2-dimethylhydrazine-induced rat colorectal?…[Pubmed:29947321] |
Frontiers in Neurology | Ursolic Acid Ameliorates Inflammation in Cerebral Ischemia and Reperfusion Injury Possibly via High Mobility Group Box 1/Toll-Like Receptor 4/NFκB?…[Pubmed:29867706] |
Journal of Functional Foods | Hepatoprotective effect of flavonoid-enriched fraction from Cyclocarya paliurus leaves on LPS/D-GalN-induced acute liver failure[10.1016:j.jff.2018.07.031] |
Inflammopharmacology | Protective effect of isoliquiritigenin against cerebral injury in septic mice via attenuation of NF-κB[Pubmed:29943151] |
Food?&?Function | Asiatic acid suppresses neuroinflammation in BV2 microglia via modulation of the Sirt1/NF-κB signaling pathway[Pubmed:29354820] |
Life?Sciences | Lipoxin A4 may attenuate the progression of obesity-related glomerulopathy by inhibiting NF-κB and ERK/p38 MAPK-dependent inflammation[Pubmed:29499280] |
Life?Sciences | Modified porcine surfactant enriched by recombinant human superoxide dismutase for experimental meconium aspiration syndrome[Pubmed:29684443] |
Life?Sciences | Alamandine attenuates sepsis-associated cardiac dysfunction via inhibiting MAPKs signaling pathways[Pubmed:29679702] |
Brain?Research | Intra-arterial human urinary kallidinogenase alleviates brain injury in rats with permanent middle cerebral artery occlusion through PI3K/AKT/FoxO1 signaling pathway[Pubmed:29510144] |
Molecular Reproduction and Development? | A proinflammatory response of bovine endometrial epithelial cells to active sperm in vitro[Pubmed:29337420] |
International Endodontic Journal | Inhibition of SOX9 Promotes Inflammatory and Immune Responses of Dental Pulp[Pubmed:29571909] |
International Journal of Molecular?Medicine | MCMV triggers ROS/NLRP3-associated inflammasome activation in the inner ear of mice and cultured spiral ganglion neurons, contributing to sensorineural hearing?…[Pubmed:29512778] |
International Journal of Molecular?Medicine | Interleukin-1β induces intercellular adhesion molecule-1 expression, thus enhancing the adhesion between mesenchymal stem cells and endothelial progenitor cells?…[Pubmed:29393395] |
Neurochemical Research | E3 Ubiquitin Ligase c-cbl Inhibits Microglia Activation After Chronic Constriction Injury[Pubmed:29934689] |
PLoS One | Chitosan oligosaccharide ameliorates acute lung injury induced by blast injury through the DDAH1/ADMA pathway[Pubmed:29415054] |
Ultrasound?in Medicine &?Biology | Validation of Musculoskeletal Ultrasound in the Assessment of Experimental Gout Synovitis[Pubmed:29703511] |
BMC?Infectious Diseases | Development of tissue inflammation accompanied by NLRP3 inflammasome activation in rabbits infected with Treponema pallidum strain Nichols[Pubmed:29490620] |
Journal of Molecular Neuroscience | A Novel scFv Anti-Aβ Antibody Reduces Pathological Impairments in APP/PS1 Transgenic Mice via Modulation of Inflammatory Cytokines and Aβ-related Enzymes[Pubmed:30062438] |
Experimental?biology?and?medicine?(Maywood) | Shock waves increase pulmonary vascular leakage, inflammation, oxidative stress, and apoptosis in a mouse model[Pubmed:29984607] |
Innate?Immunity? | Lipoxin A attenuates LPS-induced acute lung injury via activation of the ACE2-Ang-(1-7)-Mas axis[Pubmed:29969931] |
Clinical?And Experimental Pharmacology And Physiology? | Diallyl sulfide alleviates cisplatin‐induced nephrotoxicity in rats via suppressing NF‐κB downstream inflammatory proteins and p53/Puma signalling pathway[Pubmed:29266336] |
Evidence-based?Complementary and Alternative?Medicine | Bushenkangshuai Tablet Reduces Atherosclerotic Lesion by Improving Blood Lipids Metabolism and Inhibiting Inflammatory Response via TLR4 and NF-κB Signaling?…[Pubmed:29619063] |
Evidence-Based?Complementary and Alternative Medicine | Tualang Honey Reduced Neuroinflammation and Caspase-3 Activity in Rat Brain after Kainic Acid-Induced Status Epilepticus[Pubmed:30108663] |
BMC?Veterinary?Research | Inflammatory pattern of the infrapatellar fat pad in dogs with canine cruciate ligament disease[Pubmed:29769086] |
Molecular Medicine Reports | Protective effects of N (2)?L?alanyl?L?glutamine mediated by the JAK2/STAT3 signaling pathway on myocardial ischemia reperfusion[Pubmed:29393473] |
Molecular?Medicine?Reports? | Hydrogen?rich solution against myocardial injury and aquaporin expression via the PI3K/Akt signaling pathway during cardiopulmonary bypass in rats[Pubmed:29956781] |
Molecular?Medicine?Reports | Epigallocatechingallate attenuates myocardial injury in a mouse model of heart failure through TGF?β1/Smad3 signaling pathway[Pubmed:29620209] |
Medical Science Monitor | Rho Kinase Type 1 (ROCK1) Promotes Lipopolysaccharide-induced Inflammation in Corneal Epithelial Cells by Activating Toll-Like Receptor 4 (TLR4)?…[Pubmed:29804125] |
Medical Science Monitor | Emodin Attenuates Bleomycin-Induced Pulmonary Fibrosis via Anti-Inflammatory and Anti-Oxidative Activities in Rats[Pubmed:29290631] |
Medical Science Monitor | Sulforaphane, a Natural Isothiocyanate Compound, Improves Cardiac Function and Remodeling by Inhibiting Oxidative Stress and Inflammation in a Rabbit?…[Pubmed:29527002] |
Experimental?Lung?Research | Anti-IL-8 antibody potentiates the effect of exogenous surfactant in respiratory failure caused by meconium aspiration[Pubmed:29324051] |
Human and Experimental Toxicology | Neuroprotective effect of agmatine (decarboxylated -arginine) against oxidative stress and neuroinflammation in rotenone model of Parkinson's disease[Pubmed:30001633] |
Oncology?Letters | Hydrogen?rich solution attenuates myocardial injury caused by cardiopulmonary bypass in rats via the Janus?activated kinase 2/signal transducer and activator of?…[Pubmed:29928398] |
Journal of?Maternal-Fetal?&?Neonatal?Medicine | Amniotic fluid HIF1α and exosomal HIF1α in cervical insufficiency patients with physical examination-indicated cerclage[Pubmed:29357727] |
Experimental and Therapeutic Medicine | S?adenosyl methionine regulates calcium channels and inhibits uterine smooth muscle contraction in rats with infectious premature delivery through the transient?…[Pubmed:29896230] |
Animal Production Science | Omega-3 fatty acids and meloxicam supplementation and the incidence and histopathological changes associated with femoral head syndrome in broilers[10.1071:AN17713] |
International?Journal?of?Clinical?and?Experimental?Medicine | BoNT-A attenuated pain of endometriosis by inhibiting microglia activation[files:ijcem0055240.pdf] |
International Journal of Pharmacology | Evaluation of Susceptibility and Innate Immune Response to Candida albicans in Mice with Sub-health[ijp.2018.689.697] |
Journal of?Diabetes?Investigation | Relationship between serum adipsin and the first phase of glucose‐stimulated insulin secretion in individuals with different glucose tolerance[Pubmed:29432659] |
Life?Sciences | Malaysian propolis, metformin and their combination, exert hepatoprotective effect in streptozotocin-induced diabetic rats[Pubmed: 30205096] |
International?Journal?of?Clinical?and?Experimental?Medicine | The relationship between autophagy and apoptosis of lamina propria dendritic cells from the small intestine on the immunodynamics of sepsis mice[] |
European?Journal of Pharmacology | Inhibition of Rho kinase by GSK 269962 reverses both corticosterone-induced detrusor overactivity and depression-like behaviour in rats[Pubmed: 30172788] |
Acta?Medica?Mediterranea | Effects of Conventional Mechanical Ventilation Performed by Two Neonatal Ventilators on the Lung Functions of Rabbits with Meconium-Induced Acute Lung?…[Doi: 10.1515/acm-2016-0012] |
IUBMB?Life | SLC1A2 mediates refractory temporal lobe epilepsy with an initial precipitating injury by targeting the glutamatergic synapse pathway[Pubmed: 30360015] |
Neurobiology of Disease | Glucagon-like peptide-2 reduces the obesity-associated inflammation in the brain[Pubmed: 30347266] |
Journal of?Dairy?Science | Metabolism and immune status during transition period influences the lactation performance in Zebu (Bos indicus () cows[Pubmed: 17430930] |
Microbial?Pathogenesis | Total flavones of fermentation broth by co-culture of Coprinus comatus and Morchella esculenta induces an anti-inflammatory effect on LPS-stimulated RAW264. 7?…[Pubmed: 30316005] |
Experimental?Cell?Research | LL-37 inhibits LPS-induced inflammation and stimulates the osteogenic differentiation of BMSCs via P2X7 receptor and MAPK signaling pathway[Pubmed: 30287143] |
Prostaglandins?&?Other?Lipid?Mediators | Detoxification and activating blood circulation decoction reduces restenosis involving the TLR4/NF-κB pathway after balloon injury[Pubmed: 30453089] |
Biomedicine?&?Pharmacotherapy | Potential mechanisms underlying the protective effects of salvianic acid A against atherosclerosis in vivo and vitro[] |
International Journal of Molecular?Sciences | Endothelial Microsomal Prostaglandin E Synthetase-1 Upregulates Vascularity and Endothelial Interleukin-1β in Deteriorative Progression of Experimental?…[Pubmed: 30463256] |
Oxidative medicine and cellular longevity | Dietary DHA/EPA Ratio Changes Fatty Acid Composition and Attenuates Diet-Induced Accumulation of Lipid in the Liver of ApoE?/? Mice[] |
Toxicology Mechanisms and?Methods | Long-term exposure to crotonaldehyde causes heart and kidney dysfunction through induction of inflammatory and oxidative damage in male Wistar rats[Pubmed: 30426860] |
BioMed Research International | α-Tocopherol Ameliorates Redox Equilibrium and Reduces Inflammatory Response Caused by Chronic Variable Stress[] |
PLoS One | Macrophage expression of E3 ubiquitin ligase Grail protects mice from lipopolysaccharide-induced hyperinflammation and organ injury[Pubmed: 30571701] |
BBA- Molecular Basis of Disease | Enhanced remedial effects for vitamin D3 and calcium co-supplementation against pre-existing lead nephrotoxicity in mice: The roles of renal calcium homeostatic?…[Pubmed: 30553018] |
Archives of Physiology and Biochemistry | Diabetes-induced testicular oxidative stress, inflammation, and caspase-dependent apoptosis: the protective role of metformin[Pubmed: 30513216] |
International Journal of Molecular Medicine | Ginsenoside Rg1 protects against H2O2?induced neuronal damage due to inhibition of the NLRP1 inflammasome signalling pathway in hippocampal neurons in vitro[Pubmed: 30535505] |
Journal of Veterinary?Research | Early cytokine response after vaccination with Coxiella burnetii phase I in an infected herd of dairy cattle[] |
Neurochemical Research | Sinomenine Attenuates Traumatic Spinal Cord Injury by Suppressing Oxidative Stress and Inflammation via Nrf2 Pathway[Pubmed: 30603983] |
EXPERIMENTAL ANIMALS | Protective effects of sulforaphane on diabetic retinopathy: activation of the Nrf2 pathway and inhibition of NLRP3 inflammasome formation[Pubmed: 30606939] |
ACS?Applied?Materials?&?Interfaces | Rebuilding post-infarcted cardiac functions by injecting TIIA@ PDA NPs-crosslinked ROS sensitive hydrogels[Pubmed: 30592403] |
Chinese Journal of Integrative Medicine | Electroacupuncture Delays Cartilage Degeneration by Modulating Nuclear Factor-κB Signaling Pathway[Pubmed: 30656598] |
Kidney?International | Wnt/β-catenin signaling mediates both heart and kidney injury in type 2 cardiorenal syndrome[Pubmed: 30770217] |
Inflammation | Honokiol Attenuates Sepsis-Associated Acute Kidney Injury the Inhibition of Oxidative Stress and Inflammation[Pubmed: 30680694] |
Toxicology | Bradykinin contributes to immune liver injury via B2R receptor-mediated pathways in trichloroethylene sensitized mice: a role in Kupffer cell activation[Pubmed: 30685357] |
Acta?Biochimica et?Biophysica Sinica | Adiponectin attenuates lipopolysaccharide-induced cell injury of H9c2 cells by regulating AMPK pathway[Pubmed: 30668810] |
Journal of?Neuroinflammation | Anti-inflammatory and cognitive effects of interferon-β1a (IFNβ1a) in a rat model of Alzheimer's disease[Pubmed: 30777084] |
Phytotherapy?Research | Synergistic enhancement and hepatoprotective effect of combination of total phenolic extracts of L. and methotrexate for treatment of rheumatoid?…[Pubmed: 30729592] |
Journal of Biological Sciences | Maged Mohamed Abd-Elhakim Barakat, Noha Ahmed El-Boghdady, Ebtehal Kamal Eldin Farrag, Ataa Abdelhalim Said and Sylvia Edward Shaker[] |
CNS?Neuroscience & Therapeutics | Negative regulation of glial Tim‐3 inhibits the secretion of inflammatory factors and modulates microglia to antiinflammatory phenotype after experimental intracerebral?…[Pubmed: 30677253] |
International immunopharmacology | NADPH oxidase 2-mediated NLRP1 inflammasome activation involves in neuronal senescence in hippocampal neurons in vitro[Pubmed: 30677569] |
博士論文 | INSTITUTO DE CIENCIAS BáSICAS Y PRECLíNICAS “VICTORIA DE GIRóN” DEPARTAMENTO DE HISTOLOGíA[] |
Life Sciences | Rosmarinic acid attenuates inflammatory responses through inhibiting HMGB1/TLR4/NF-κB signaling pathway in a mouse model of Parkinson's disease[] |
Cellular?and Molecular Neurobiology | Microglia-Derived Adiposomes are Potential Targets for the Treatment of Ischemic Stroke[Pubmed: 30852719] |
Royal?Society?Open?Science | Metabolomics analysis of baicalin on ovalbumin-sensitized allergic rhinitis rats[] |
博士論文 | 6. Manuscript II: Evaluation of IL-1β levels in epilepsy and traumatic brain injury in dogs[] |
Experimental?Biology?and?Medicine | Grape seed proanthocyanidin extract alleviates arsenic-induced lung damage through NF-κB signaling[Pubmed: 30869553] |
Journal of Biological Sciences | Protective and Curative Effects of Bombax ceiba Flower and Ziziphus spina christi Fruit Extracts on Gastric Ulcer[] |
Journal of?Animal?Science | Adipose tissue proteomic analysis in ketotic or healthy Holstein cows in early lactation[Pubmed: 30985866] |
Journal of?Pineal?Research | Role of melatonin in sleep deprivation‐induced intestinal barrier dysfunction in mice[Pubmed: 30929267] |
Life?Sciences | 1, 25-(OH) 2D3 protects Schwann cells against advanced glycation end products-induced apoptosis through PKA-NF-κB pathway[Pubmed: 30928409] |
Toxicon | The wound healing potential of a pro-angiogenic peptide purified from Indian Russell's viper (Daboia russelii) venom[Pubmed: 31054289] |
Mucosal Immunology | Irf5 deficiency in myeloid cells prevents necrotizing enterocolitis by inhibiting M1 macrophage polarization[Pubmed: 31086271] |
The role of amniotic fluid exosome, hypoxia inducible fator-1α, and inflammatory cytokine in cervical insufficiency[] | |
pharmacological research | Neuroprotection in non-transgenic and transgenic mouse models of Alzheimer's disease by positive modulation of σ1 receptors[Pubmed: 31048034] |
Stem Cell Reviews and Reports | The Nlrp3 Inflammasome Orchestrates Mobilization of Bone Marrow-Residing Stem Cells into Peripheral Blood[Pubmed: 31089880] |
IUBMB Life | Melatonin Enhances Autophagy and Decreases Apoptosis Induced by nanosilica in RAW264. 7 cells[Pubmed: 31018046] |
Phytotherapy Research | Total flavonoids from sea buckthorn ameliorates lipopolysaccharide/cigarette smoke‐induced airway inflammation[Pubmed: 31209984] |
American Journal of Reproductive Immunology | Effect of alpha lipoic acid and myoinositol on endometrial inflammasome from recurrent pregnancy loss women[Pubmed: 31148259] |
BMC NEUROSCIENCE | Evaluation of IL-1β levels in epilepsy and traumatic brain injury in dogs[Pubmed: 31208341] |
Pharmacological Research | Ethanol extracts of Danlou tablet attenuate atherosclerosis via inhibiting inflammation and promoting lipid effluent[Pubmed: 31181336] |
Frontiers in Immunology | Expression and Purification of Hybrid LL-37Tα1 Peptide in Pichia pastoris and evaluation of their Immunomodulatory and anti-inflammatory activities by LPS?…[] |
Food & Function | Network pharmacology oriented study reveals inflammatory state-dependent dietary supplement hepatotoxicity responses in normal and diseased rats[Pubmed: 31140472] |
Journal of the Royal Army Medical Corps | CD28 deficiency attenuates primary blast-induced renal injury in mice via the PI3K/Akt signalling pathway[Pubmed: 31129646] |
Metallomics | Lanthanum chloride induces neuron damage by activating the nuclear factor-kappa B signaling pathway in activated microglia[Pubmed: 31187842] |
Pinealektomize Edilmi? Septik S??anlarda TNF-α, IL-6, IL-10 ve IL-1β'nin Kan Düzeyleri ile Karaci?er ve B?brekte Gen Ekspresyonu Seviyelerindeki?…[Doi: 10.5505/vtd.2019.32815] | |
Journal of Neurochemistry | Crosstalk between Cdk5/p35 and ERK1/2 signalling mediates spinal astrocyte activity via the PPARγ pathway in a rat model of chronic constriction injury[Pubmed: 31314915] |
Nature Chemical Biology | S-glycosylation-based cysteine profiling reveals regulation of glycolysis by itaconate[Pubmed: 31332308] |
neuroscience letters | Madecassoside ameliorates lipopolysaccharide-induced neurotoxicity in rats by activating the Nrf2-HO-1 pathway[Pubmed: 31330225] |
Free Radical Biology and Medicine | Vitamin D protects against oxidative stress, inflammation and hepatorenal damage induced by acute paracetamol toxicity in rat[Pubmed: 31255668] |
Nanomedicine | Antihyperuricemic and anti-gouty arthritis activities of Aurantii fructus immaturus carbonisata-derived carbon dots[Pubmed: 31418646] |
Food & Function | A dietary polysaccharide from Eucheuma cottonii downregulates proinflammatory cytokines and ameliorates osteoarthritis-associated cartilage degradation in obese?…[] |
Inflammopharmacology | Betulinic acid attenuates lipopolysaccharide-induced vascular hyporeactivity in the rat aorta by modulating Nrf2 antioxidative function[Pubmed: 31352642] |
Phytomedicine | Novel evidence that an alternative complement cascade pathway is involved in optimal mobilization of hematopoietic stem/progenitor cells in Nlrp3?…[] |
Int Immunopharmacol | Metallothionein-1 is associated with osteoarthritis disease activity and suppresses proinflammatory cytokines production in synovial cells[Pubmed: 31465913] |
Animals | Anti-Inflammatory State in Arabian Horses Introduced to the Endurance Training[Pubmed: 31462005] |
Frontiers in Pharmacology | Naoxintong Capsule Inhibits the Development of Cardiovascular Pathological Changes in Bama Minipig Through Improving Gut Microbiota[Pubmed: 31632272] |
International Journal of Molecular Sciences | Cichorium intybus L. Extract Suppresses Experimental Gout by Inhibiting the NF-κB and NLRP3 Signaling Pathways[Pubmed: 31590257] |
Scientific Reports | Anti-inflammatory and antioxidant effects of muscarinic acetylcholine receptor (mAChR) activation in the rat hippocampus[Pubmed: 31578381] |
Journal of Medicinal Food | Polysaccharide from the Seeds of Plantago asiatica L. Protect Against Lipopolysaccharide-Induced Liver Injury[Pubmed: 31560611] |
Molecular Medicine Reports | High?fat treatment prevents postoperative cognitive dysfunction in a hyperlipidemia model by protecting the blood?brain barrier via Mfsd2a?related signaling[Pubmed: 31545471] |
Antioxidants | Oxidative Stress, NF-κB-Mediated Inflammation and Apoptosis in the Testes of Streptozotocin–Induced Diabetic Rats: Combined Protective Effects of Malaysian?…[Pubmed: 31600920] |
LIFE SCIENCES | Protective effects of epigallocatechin gallate against ischemia reperfusion injury in rat skeletal muscle via activating Nrf2/HO-1 signaling pathway[Pubmed: 31678278] |
BMC Complementary and Alternative Medicine | Qingkailing injection ameliorates cerebral ischemia-reperfusion injury and modulates the AMPK/NLRP3 Inflammasome Signalling pathway[Pubmed: 31747940] |
life sciences | Melatonin biosynthesis restored by CpG oligodeoxynucleotides attenuates allergic airway inflammation via regulating NLRP3 inflammasome[Pubmed: 31738882] |
international journal of molecular sciences | Anti-Inflammatory and Anti-Apoptotic Effects of Stybenpropol A on Human Umbilical Vein Endothelial Cells[Pubmed: 31671764] |
Journal of Controlled Release | Ginsenoside Rg3-loaded, reactive oxygen species-responsive polymeric nanoparticles for alleviating myocardial ischemia-reperfusion injury[Pubmed: 31783047] |
Journal of Food Science | Effects of Total Flavonoids from Exocarpium Citri Grandis on Air Pollution Particle‐Induced Pulmonary Inflammation and Oxidative Stress in Mice[Pubmed: 31762039] |
Cytokine | Levels of pro-and anti-inflammatory cytokines in cystic fibrosis patients with or without gingivitis[Pubmed: 31927460] |
Journal of?Photochemistry and?Photobiology?B | Neuroprotective effect of Wogonin on Rat's brain exposed to gamma irradiation[Pubmed: 31935591] |
Archives of Biochemistry and Biophysics | Syringin protects against colitis by ameliorating inflammation[Pubmed: 31899146] |
International Journal of Molecular Sciences | Pistachio Consumption Alleviates Inflammation and Improves Gut Microbiota Composition in Mice Fed a High-Fat Diet[Pubmed: 31935892] |
Pharmacology Biochemistry and Behavior | Duloxetine reverses the symptoms of overactive bladder co-existing with depression via the central pathways[Pubmed: 31899220] |
Frontiers in Immunology | The Increase in IL-1β in the Early Stage of Heatstroke Might Be Caused by Splenic Lymphocyte Pyroptosis Induced by mtROS-Mediated Activation of the?…[Pubmed: 31921131] |
Nutrients | Rotundic Acid Protects against Metabolic Disturbance and Improves Gut Microbiota in Type 2 Diabetes Rats[Pubmed: 31887996] |
GENES TO CELLS | MiR‐29c‐3p inhibits microglial NLRP3 inflammasome activation by targeting NFAT5 in Parkinson's disease[Pubmed: 32160394] |
Nanomedicine | The toxicity of alumina nanoparticles to immune system in mice[Pubmed: 32162999] |
Frontiers in Pharmacology | Toddalolactone Protects Lipopolysaccharide-Induced Sepsis and Attenuates Lipopolysaccharide-Induced Inflammatory Response by Modulating HMGB1-NF …[Pubmed: 32153412] |
Endocrine | Glucagon-like peptide-2 analog and inflammatory state in obese mice[Pubmed: 32172484] |
Biomed Pharmacother | Suppression of Fpr2 expression protects against endotoxin-induced acute lung injury by interacting with Nrf2-regulated TAK1 activation[Pubmed: 32106380] |
BRAIN BEHAVIOR AND IMMUNITY | AVNP2 protects against cognitive impairments induced by C6 glioma by suppressing tumour associated inflammation in rats[Pubmed: 32097763] |
Frontiers in Microbiology | Topical Therapeutic Efficacy of Ebselen Against Multidrug-Resistant Staphylococcus aureus LT-1 Targeting Thioredoxin Reductase[Pubmed: 32010088] |
Biomed Pharmacother | Deletion of macrophage migration inhibitory factor ameliorates inflammation in mice model severe acute pancreatitis[Pubmed: 32062385] |
Frontiers in Immunology | TLR2-Melatonin Feedback Loop Regulates the Activation of NLRP3 Inflammasome in Murine Allergic Airway Inflammation[Pubmed: 32117301] |
JOURNAL OF HAZARDOUS MATERIALS | Silica nanoparticles induce JNK-mediated inflammation and myocardial contractile dysfunction[Pubmed: 32036317] |
Biomed Research International | Hydrogen-Rich Saline Inhibits Lipopolysaccharide-Induced Acute Lung Injury and Endothelial Dysfunction by Regulating Autophagy through mTOR/TFEB …[Pubmed: 32071922] |
Epilepsy Behav | Metformin and trimetazidine ameliorate diabetes-induced cognitive impediment in status epileptic rats[Pubmed: 32000097] |
Archives of Biochemistry and Biophysics | Micro RNA 146a gene variant/TNF-α/IL-6/IL-1 β; A cross-link axis inbetween oxidative stress, endothelial dysfunction and neuro-inflammation in acute ischemic stroke …[Pubmed: 31738890] |
Oxidative Medicine and Cellular Longevity | Dexmedetomidine Attenuates Orthotopic Liver Transplantation-Induced Acute Gut Injury via α2-Adrenergic Receptor-Dependent Suppression of Oxidative Stress[Pubmed: 31827710] |
Medical Science Monitor | MicroRNA-27a-3p Downregulation Inhibits Inflammatory Response and Hippocampal Neuronal Cell Apoptosis by Upregulating Mitogen-Activated Protein Kinase 4?…[Pubmed: 31710596] |
Molecular Therapy - Nucleic Acids | Systematic transcriptome and regulatory network analyses reveal the hypoglycemic mechanism of Dendrobium fimbriatum[Pubmed: 31790971] |
Chinese Journal of Natural Medicines | Shenfu injection attenuates lipopolysaccharide-induced myocardial inflammation and apoptosis in rats[Pubmed: 32245593] |
International Journal of Molecular Medicine | Ligustrazine ameliorates lipopolysaccharide?induced neurocognitive impairment by activating autophagy via the PI3K/AKT/mTOR pathway[Pubmed: 32236586] |
Journal of Pharmacy and Pharmacology | Tectorigenin inhibits inflammation and pulmonary fibrosis in allergic asthma model of ovalbumin‐sensitized guinea pigs[Pubmed: 32314371] |
veterinary research | Newcastle disease virus RNA-induced IL-1β expression via the NLRP3/caspase-1 inflammasome[Pubmed: 32293543] |
molecular immunology | STAT5a induces endotoxin tolerance by alleviating pyroptosis in kupffer cells[Pubmed: 32298872] |
journal of dairy science | Mitochondrial membrane protein mitofusin 2 as a potential therapeutic target for treating free fatty acid–induced hepatic inflammation in dairy cows during early?…[Pubmed: 32278565] |
Inflammation | Cyanidin-3-O-Glucoside Attenuates Lipopolysaccharide-Induced Inflammation in Human Corneal Epithelial Cells by Inducing Let-7b-5p-Mediated HMGA2/PI3K/Akt?…[Pubmed: 32248330] |
Pharmazie | Anti-inflammatory effects of ginsenoside Rg3 on the hypertrophic scar formation via the NF-κB/IκB signaling pathway in rabbit ears[Pubmed: 32213242] |
Marine Drugs | Tu-Teng-Cao Extract Alleviates Monosodium Urate-Induced Acute Gouty Arthritis in Rats by Inhibiting Uric Acid and Inflammation[Pubmed: 23306170] |
Nanomaterials | An OMV-Based Nanovaccine Confers Safety and Protection against Pathogenic Escherichia coli via Both Humoral and Predominantly Th1 Immune Responses in?…[Pubmed: 33233490] |
LIFE SCIENCES | Intravitreal conbercept improves outcome of proliferative diabetic retinopathy through inhibiting inflammation and oxidative stress[Pubmed: 33227274] |
VETERINARY MICROBIOLOGY | Upregulation of HMGB1 Secretion in Lungs of Pigs Infected by Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus[Pubmed: 33221069] |
Exp Lung Res | Ketogenic diet induces autophagy to alleviate bleomycin-induced pulmonary fibrosis in murine models[Pubmed: 33121292] |
BIOMEDICINE & PHARMACOTHERAPY | The influence of Potentilla chinensis aqueous extract on urinary bladder function in retinyl acetate-induced detrusor overactivity in rats[Pubmed: 33113423] |
Cell Biochem Funct | The role of Smad4 in the regulation of insulin resistance, inflammation and cell proliferation in HTR8‐Svneo cells[Pubmed: 33079408] |
Neuroscience | A new therapeutic strategy targeting protein deacetylation for spinal cord injury[Pubmed: 33039524] |
J Diabetes | Integrative analysis of hepatic metabolomic and transcriptomic data reveals potential mechanism of non‐alcoholic steatohepatitis in high‐fat diet‐fed mice[Pubmed: 33022884] |
BIOMEDICINE & PHARMACOTHERAPY | Chlorogenic acid prevents acute myocardial infarction in rats by reducing inflammatory damage and oxidative stress[Pubmed: 33022535] |
DRUG AND CHEMICAL TOXICOLOGY | Toxicological impact of sodium benzoate on inflammatory cytokines, oxidative stress and biochemical markers in male Wistar rats[Pubmed: 33003960] |
Antioxidants | Involvement of HO-1 and Autophagy in the Protective Effect of Magnolol in Hepatic Steatosis-Induced NLRP3 Inflammasome Activation In Vivo and In Vitro[Pubmed: 32992548] |
Autophagy | LDHB inhibition induces mitophagy and facilitates the progression of CSFV infection[Pubmed: 32924761] |
J Cell Mol Med | LIGHT aggravates sepsis‐associated acute kidney injury via TLR4‐MyD88‐NF‐κB pathway[Pubmed: 32881263] |
Nanotoxicology | miR-205/IRAK2 signaling pathway is associated with urban airborne PM2.5-induced myocardial toxicity[Pubmed: 32880512] |
Drug Design Development and Therapy | Exosomes Derived from MicroRNA-146a-5p-Enriched Bone Marrow Mesenchymal Stem Cells Alleviate Intracerebral Hemorrhage by Inhibiting Neuronal?…[Pubmed: 32821084] |
Biochimie | Exosomes derived from TSG-6 modified mesenchymal stromal cells attenuate scar formation during wound healing[Pubmed: 32800897] |
INVESTIGATIONAL NEW DRUGS | Dual-function chimeric antigen receptor T cells targeting c-Met and PD-1 exhibit potent anti-tumor efficacy in solid tumors[Pubmed: 32772342] |
Peptides | Liraglutide ameliorates lipotoxicity-induced inflammation through the mTORC1 signalling pathway[Pubmed: 32771373] |
Scientific Reports | Beneficial effects of manually assisted chiropractic adjusting instrument in a rabbit model of osteoarthritis[Pubmed: 32764579] |
Journal of Natural Medicines | Preventive effect of dioscin against monosodium urate-mediated gouty arthritis through inhibiting inflammasome NLRP3 and TLR4/NF-κB signaling pathway activation?…[Pubmed: 32761488] |
MOLECULAR AND CELLULAR BIOCHEMISTRY | MicroRNA-217 ameliorates inflammatory damage of endothelial cells induced by oxidized LDL by targeting EGR1[Pubmed: 32737769] |
Int Immunopharmacol | BNIP3 deletion ameliorated enterovirus 71 infection-induced hand, foot and mouth disease via inhibiting apoptosis, autophagy, and inflammation in mice[Pubmed: 32717566] |
BRAIN BEHAVIOR AND IMMUNITY | Active smoking, sleep quality and cerebrospinal fluid biomarkers of neuroinflammation[Pubmed: 32717405] |
molecular immunology | TLR9 mediates the activation of NLRP3 inflammasome and oxidative stress in murine allergic airway inflammation[Pubmed: 32623292] |
Scientific Reports | Integrated metabolomics and gut microbiome to the effects and mechanisms of naoxintong capsule on type 2 diabetes in rats[Pubmed: 32616735] |
european journal of pharmacology | The effect of O-1602, a GPR55 agonist, on the cyclophosphamide-induced rat hemorrhagic cystitis[Pubmed: 32615180] |
Frontiers in Bioengineering and Biotechnology | In vitro Impact of Yeast Expressed Hybrid Peptide CATH-2TP5 as a Prophylactic Measure Toward Sepsis and Inflammation[Pubmed: 32582649] |
Journal of Neuroinflammation | CX3CR1-microglia mediates neuroinflammation and blood pressure regulation in the nucleus tractus solitarii of fructose-induced hypertensive rats[Pubmed: 32532282] |
Frontiers in Pharmacology | Oxymatrine Attenuates Dopaminergic Neuronal Damage and Microglia-Mediated Neuroinflammation Through Cathepsin D-Dependent HMGB1/TLR4/NF-κB …[Pubmed: 32528295] |
Life Sci | Puerarin ameliorates retinal ganglion cell damage induced by retinal ischemia/reperfusion through inhibiting the activation of TLR4/NLRP3 inflammasome[Pubmed: 32526286] |
Brain and Behavior | bFGF promotes neurological recovery from neonatal hypoxic–ischemic encephalopathy by IL‐1β signaling pathway‐mediated axon regeneration[Pubmed: 32525289] |
American Journal of Translational Research | Inhibition of calpain alleviates coxsackievirus B3-induced myocarditis through suppressing the canonical NLRP3 inflammasome/caspase-1-mediated and …[Pubmed: 32509190] |
Frontiers in Pharmacology | Hyperoside Protects Human Umbilical Vein Endothelial Cells Against Anticardiolipin Antibody-Induced Injury by Activating Autophagy[Pubmed: 32508661] |
Clinical Oral Investigations | Bone microRNA-21 as surgical stress parameter is associated with third molar postoperative discomfort[Pubmed: 32495225] |
STEM CELL REVIEWS AND REPORTS | A Novel Evidence That Mannan Binding Lectin (MBL) Pathway of Complement Cascade Activation is Involved in Homing and Engraftment of Hematopoietic Stem …[Pubmed: 32406006] |
Int J Mol Sci | Effects of PDE3 Inhibitor Olprinone on the Respiratory Parameters, Inflammation, and Apoptosis in an Experimental Model of Acute Respiratory Distress Syndrome[Pubmed: 32403267] |
Int Immunopharmacol | Celastrol attenuates collagen-induced arthritis via inhibiting oxidative stress in rats[Pubmed: 32402948] |
Molecular Biology Reports | The effect of subacute poisoning with fenpropathrin on mice kidney function and the level of interleukin 1β and tumor necrosis factor α.[Pubmed: 32385770] |
european journal of pharmaceutical sciences | Stimulation of atypical cannabinoid receptor GPR55 abolishes the symptoms of detrusor overactivity in spontaneously hypertensive rats[Pubmed: 32360768] |
BIOSCIENCE REPORTS | IL-38 restrains inflammatory response of collagen-induced arthritis in rats via SIRT1/HIF-1α signaling pathway[Pubmed: 32347300] |
BIOMEDICINE & PHARMACOTHERAPY | Protective effects of bee bread on testicular oxidative stress, NF-κB-mediated inflammation, apoptosis and lactate transport decline in obese male rats[Pubmed: 33152939] |
ACS Chemical Neuroscience | α-Synuclein Exhibits Differential Membrane Perturbation, Nucleation, and TLR2 Binding through Its Secondary Structure[Pubmed: 33196165] |
Nutrition | Changes in peripheral inflammation-related gene expression by postprandial glycemic response in healthy Japanese men[Pubmed: 33131984] |
Journal of Diabetes Research | Regulation and Mechanism of miR-518d through the PPARα-Mediated NF-κB Pathway in the Development of Gestational Diabetes Mellitus[Pubmed: 33123597] |
International Immunopharmacology | Echinacea polysaccharide alleviates LPS-induced lung injury via inhibiting inflammation, apoptosis and activation of the TLR4/NF-κB signal pathway[Pubmed: 33182056] |
Biomedicine & Pharmacotherapy | Cepharanthine attenuates cerebral ischemia/reperfusion injury by reducing NLRP3 inflammasome-induced inflammation and oxidative stress via inhibiting 12?…[Pubmed: 32559840] |
European Review for Medical and Pharmacological Sciences | Neuroprotective effect of CTRP3 overexpression against sevoflurane anesthesia-induced cognitive dysfunction in aged rats through activating AMPK/SIRT1 and …[Pubmed: 32432773] |
Domestic Animal Endocrinology | A Preliminary Evaluation of the Circulating Leptin/Adiponectin Ratio in Dogs with Pituitary-Dependent Hyperadrenocorticism and concurrent diabetes mellitus[Pubmed: 32920447] |
Biomedicine & Pharmacotherapy | Qingfei oral liquid alleviates airway hyperresponsiveness and mucus hypersecretion via TRPV1 signaling in RSV-infected asthmatic mice[Pubmed: 32521453] |
International Journal of Nanomedicine | Effect of Lonicerae japonicae Flos Carbonisata-Derived Carbon Dots on Rat Models of Fever and Hypothermia Induced by Lipopolysaccharide[Pubmed: 32606669] |
Frontiers in Pharmacology | O-1602, an Agonist of Atypical Cannabinoid Receptors GPR55, Reverses the Symptoms of Depression and Detrusor Overactivity in Rats Subjected to?…[Pubmed: 32733244] |
Inflammation | Tetramethylpyrazine Inhibits Platelet Adhesion and Inflammatory Response in Vascular Endothelial Cells by Inhibiting P38 MAPK and NF-κB Signaling Pathways[] |
Indian Journal of Animal Sciences | Peripheral concentrations of metabolic and inflammatory indicators during transition period and their relationship with postpartum clinical endometritis in dairy?…[] |
Food & Function | Nicotinamide riboside alleviates alcohol-induced depression-like behaviours in C57BL/6J mice by altering the intestinal microbiota associated with microglial?…[] |
Food and Agricultural Immunology | Acrylamide induced the activation of NLRP3 inflammasome via ROS-MAPKs pathways in Kupffer cells[] |
Nanoscale Research Letters | Protective Effects of Carbon Dots Derived from Phellodendri Chinensis Cortex Carbonisata against Deinagkistrodon acutus Venom-Induced Acute Kidney?…[] |
Journal of Biochemical and Molecular Toxicology | Vitamin D3 and calcium cosupplementation alleviates cadmium hepatotoxicity in the rat: Enhanced antioxidative and anti‐inflammatory actions by remodeling cellular?…[] |
Biotechnology & Biotechnological Equipment | Honokiol inhibits inflammation and endoplasmic reticulum stress in a rat model of pregnancy-induced hypertension[] |
Journal of Functional Foods | Wine pomace product modulates oxidative stress and microbiota in obesity high-fat diet-fed rats[] |
Journal of Functional Foods | Polyphenolic extracts from Wushan tea leaves attenuate hepatic injury in CCl4-treated mice[] |
Microbiome changes in patients with chronic heart failure with preserved ejection fraction correlate with fibrosis markers: Description of a Russian cohort[] | |
Iranian Journal of Allergy, Asthma and Immunology | Increased Level of Caspase-1 in the Serum of Relapsing-remitting Multiple Sclerosis (RRMS) Patients[] |
Interferon regulatory factor 8 induces alveolar macrophage hypoxia/reoxygenation injury via the PINK1/Parkin mitophagy pathway[] | |
Phytomedicine | Menthacarin attenuates experimental colitis[] |
ACS Biomaterials Science & Engineering | Tissue-Engineered Decellularized Allografts for Anterior Cruciate Ligament Reconstruction[] |
The Role of Inflammatory Cytokine and Inflammatory Regulator Protein Related to Severity of Joint Effusion in Osteoarthritis[] | |
Tempuyung Leaves (Sonchus arvensis) Ameliorates Monosodium Urate Crystal-Induced Gouty Arthritis in Rats through Anti-Inflammatory Effects[] | |
Overektomize di?i s??anlarda beyin oksidatif stres, bdnf ve inflamatuar cevap düzeyleri ile n?rodavran??sal de?i?iklikler üzerine anjiyotensin II ?nhibisyonunun etkisi[] | |
Drug Dev Res | Paeoniflorin inhibited nod?\like receptor protein?\3 inflammasome and NF?\|êB?\mediated inflammatory reactions in diabetic foot ulcer by inhibiting the chemokine??-[33236457] |
Respir Physiol Neurobiol | Protective effect of Toll-interacting protein overexpression against paraquat-induced lung injury in mice and A549 cells through inhibiting oxidative stress??-[33333238] |
Scientific Reports | Immunogenicity and protective efficacy of enterotoxigenic Escherichia coli (ETEC) total RNA against ETEC challenge in a mouse model[33239756] |
Nutrients | AphaMax?, an Aphanizomenon Flos-Aquae Aqueous Extract, Exerts Intestinal Protective Effects in Experimental Colitis in Rats[33256017] |
Bull Exp Biol Med | Inflammation Mediators Regulate the Microbiota Resistance to Adverse Factors[33222085] |
Int J Mol Med | Astragaloside IV alleviates silica?induced pulmonary fibrosis via inactivation of the TGF?|?1/Smad2/3 signaling pathway[33448318] |
Biochem Pharmacol | Inactivation of Wnt/|?-catenin/renin angiotensin axis by tumor necrosis factor-alpha inhibitor, infliximab, ameliorates CKD induced in rats[33482150] |
Stem Cell Reviews and Reports | Prospects on the Potential In Vitro Regenerative Features of Mechanically Treated-Adipose Tissue for Osteoarthritis Care[33469783] |
EUROPEAN JOURNAL OF PHARMACOLOGY | Gliclazide alters macrophages polarization state in diabetic atherosclerosis in vitro via blocking AGE-RAGE/TLR4-reactive oxygen species-activated NF-k|? nexus[33460615] |
Molecules | Alpha-Lipoic Acid Plays a Role in Endometriosis: New Evidence on Inflammasome-Mediated Interleukin Production, Cellular Adhesion and Invasion[33430011] |
MEDIATORS OF INFLAMMATION | MMP-9 Concentration in Peritoneal Fluid Is a Valuable Biomarker Associated with Endotoxemia in Equine Colic[33488296] |
Mol Cell Biochem | Intermittent high glucose induces pyroptosis of rat H9C2 cardiomyocytes via sodium¨Cglucose cotransporter 1[33608832] |
Life Sci | Celecoxib ameliorates liver cirrhosis via reducing inflammation and oxidative stress along spleen-liver axis in rats[33577848] |
Life Sci | Inhibition of SGLT1 protects against glycemic variability-induced cardiac damage and pyroptosis of cardiomyocytes in diabetic mice[33508297] |
Animal | Effect of alfalfa hay and starter feed supplementation on caecal microbiota and fermentation, growth, and health of yak calves[33610512] |
european journal of clinical nutrition? | Effect of Lactobacillus casei on lipid metabolism and intestinal microflora in patients with alcoholic liver injury[33514869] |
Int Immunopharmacol | Ginkgolide A attenuates sepsis-associated kidney damage via upregulating microRNA-25 with NADPH oxidase 4 as the target[33677255] |
Tissue Cell | Protective effects of Oridonin against cerebral ischemia/reperfusion injury by inhibiting the NLRP3 inflammasome activation[33676236] |
bmc pediatrics | Factors associated with neurodevelopment in preterm infants with systematic inflammation[33685414] |
INFLAMMATION | Acid Sphingomyelinase and Acid |?-Glucosidase 1 Exert Opposite Effects on Interleukin-1|?-Induced Interleukin 6 Production in Rheumatoid Arthritis Fibroblast-Like Synoviocytes[33665756] |
JOURNAL OF PERIODONTAL RESEARCH | Potential biomarkers reflecting inflammation in patients with severe periodontitis: Fractalkine (CX3CL1) and its receptor (CX3CR1)[33641164] |
Biochem Cell Biol | Formononetin protects against concanavalin-A-induced autoimmune hepatitis in mice through its anti-apoptotic and anti-inflammatory properties[33749318] |
J Physiol Biochem | Autophagy blockage promotes the pyroptosis of ox-LDL-treated macrophages by modulating the p62/Nrf2/ARE axis[33886081] |
Hum Exp Toxicol | Alamandine significantly reduces doxorubicin-induced cardiotoxicity in rats[33882726] |
NEUROSCIENCE RESEARCH | Sleep disturbance induces depressive behaviors and neuroinflammation by altering the circadian oscillations of clock genes in rats[33785408] |
FASEB Bioadv | Cyclophilin A induces macrophage apoptosis and enhances atherosclerotic lesions in high?\fat diet?\fed hyperglycemic rabbits[33977232] |
Arch Biochem Biophys | Vitamin D ameliorates high-fat-diet-induced hepatic injury via inhibiting pyroptosis and alters gut microbiota in rats[33965368] |
Randomized Controlled Trial | Effect of Freeze-Dried Amnion Graft on Cytokines in Uterine Exudates Following Hysteroscopic Adhesiolysis of Severe Intrauterine Adhesions[28170094] |
Orthop Surg | Proline?\Serine¨CThreonine Phosphatase?\Interacting Protein 2 Alleviates Diabetes Mellitus?\Osteoarthritis in Rats through Attenuating Synovial Inflammation and??-[33939302] |
Biomed Pharmacother | Captopril downregulates expression of Bax/cytochrome C/caspase-3 apoptotic pathway, reduces inflammation, and oxidative stress in cisplatin-induced acute??-[33945910] |
PLoS One | Beneficial impact of cathelicidin on hypersensitivity pneumonitis treatment?aIn vivo studies[33999928] |
Nephron | Dexmedetomidine Exerts Renal Protective Effect by Regulating the PGC-1|á/STAT1/IRF-1 Axis[33965939] |
Stem Cell Research & Therapy | Consecutive daily administration of intratracheal surfactant and human umbilical cord-derived mesenchymal stem cells attenuates hyperoxia-induced lung??-[33933128] |
BMC Pharmacology & Toxicology | Subacute poisoning with bifenthrin increases the level of interleukin 1? in mice kidneys and livers[33902677] |
Clin Oral Investig | Evaluation of heat shock protein 70 and toll-like receptor 4 expression in gingival crevicular fluid in response to orthodontic forces[34091792] |
Placenta | Vitamin D alleviates hypoxia/reoxygenation-induced injury of human trophoblast HTR-8 cells by activating autophagy[34126416] |
Chem Biol Interact | Hepatoprotective effect of anemoside B4 against sepsis-induced acute liver injury through modulating the mTOR/p70S6K-mediated autophagy[34051206] |
Med Sci Monit | Post-Treatment Sevoflurane Protects Against Hypoxic-Ischemic Brain Injury in Neonatal Rats by Downregulating Histone Methyltransferase G9a and Upregulating ?-[34059615] |
Exp Eye Res | Topical calcitriol application promotes diabetic corneal wound healing and reinnervation through inhibiting NLRP3 inflammasome activation[34144035] |
BioMed Research International | Ultrashort Wave Combined with Human Umbilical Cord Mesenchymal Stem Cell (HUC-MSC) Transplantation Inhibits NLRP3 Inflammasome and Improves??-[33376718] |
Evidence-Based Complementary and Alternative Medicine | Zisheng Shenqi Decoction Ameliorates Monosodium Urate-Mediated Gouty Arthritis in Rats via Promotion of Autophagy through the AMPK/mTOR Signaling??-[33505502] |
Basic and Clinical Neuroscience | Paeonol Protects Against Intrastriatal 6-Hydroxydopamine Rat Model of Parkinson's Disease[33995926] |
BioMed Research International | MiR-599 Protects Cardiomyocytes against Oxidative Stress-Induced Pyroptosis[33681353] |
cells | The Effect of the Clenbuterol?a|?2-Adrenergic Receptor Agonist on the Peripheral Blood Mononuclear Cells Proliferation, Phenotype, Functions, and Reactive Oxygen??-[33920705] |
Antioxidants | Hidrox? Roles in Neuroprotection: Biochemical Links between Traumatic Brain Injury and Alzheimer's Disease[34065584] |
Melatonin-mediated MT2 attenuates colitis induced by dextran sodium sulfate via PI3K/AKT/Nrf2/SIRT1/ROR|á/NF-|êB signaling pathways[34162146] | |
Natural Product Communications | Oral Administration of Salmon Cartilage Proteoglycan Attenuates Osteoarthritis in a Monosodium Iodoacetate-Induced Rat Model[] |
Journal of Alzheimer's disease | DAla2-GIP-GLU-PAL Protects Against Cognitive Deficits and Pathology in APP/PS1 Mice by Inhibiting Neuroinflammation and Up-regulating cAMP/PKA/CREB??-[] |
researchsquare | p62 promotes HIV-1 gp120 V3 loop-mediated microglial inflammation by promoting noncanonical activation of Nrf2[] |
Berberine Attenuates Neonatal Sepsis in Rats By Inhibiting FOXA1 and NF-|êB Signaling Transduction Via The Induction of miR-132-3p[] | |
biomolecules | Treadmill Running Changes Endothelial Lipase Expression: Insights from Gene and Protein Analysis in Various Striated Muscle Tissues and Serum[] |
Antioxidants | Oxidative Stress Mediates Vascular Tortuosity[] |
Peptides | Angiotensin-(1-7) protects against sepsis-associated left ventricular dysfunction induced by lipopolysaccharide[34298021] |
Cancer Lett | Photodynamic therapy induces human esophageal carcinoma cell pyroptosis by targeting the PKM2/caspase-8/caspase-3/GSDME axis[34256094] |
J Pharm Pharmacol | Alamandine protects against renal ischaemia–reperfusion injury in rats via inhibiting oxidative stress[34244746] |
Food Chem Toxicol | GR-mediated anti-inflammation of α-boswellic acid: Insights from in vitro and in silico studies[34197882] |
Front Pharmacol | In Silico and In Vivo Studies on the Mechanisms of Chinese Medicine Formula (Gegen Qinlian Decoction) in the Treatment of Ulcerative Colitis[34177580] |
J Cell Mol Med | Puerarin attenuates intracerebral hemorrhage‐induced early brain injury possibly by PI3K/Akt signal activation‐mediated suppression of NF‐κB pathway[34180121] |
Aging | Yiqi Jiemin decoction alleviates allergic rhinitis in a guinea pig model by suppressing inflammation, restoring Th1/Th2 balance, and improving cellular?…[34315133] |
Peptides | Alamandine, a derivative of angiotensin-(1-7), alleviates sepsis-associated renal inflammation and apoptosis by inhibiting the PI3K/Ak and MAPK pathways[34400214] |
J Neuroinflammation | Inhibition of heat shock protein family A member 8 attenuates spinal cord ischemia–reperfusion injury via astrocyte NF-κB/NLRP3 inflammasome pathway[34362408] |
Medicine (Baltimore) | Clinical value of CD97 and CD55 levels in the differential diagnosis of tuberculous and malignant pleural effusions[34397724] |
Mol Med Rep | Sacubitril/valsartan (LCZ696) reduces myocardial injury following myocardial infarction by inhibiting NLRP3?induced pyroptosis via the TAK1/JNK signaling pathway[34296299] |
J Asthma | Clinical and Biological Indicators of Periodontal Disease in Obese and non-Obese adults with and without Bronchial Asthma[34324826] |
Int Immunopharmacol | The protective effect of isoflurane pretreatment on liver IRI by suppressing noncanonical pyroptosis of liver macrophages[34332342] |
Inflammation | Berberine Attenuates Neonatal Sepsis in Mice By Inhibiting FOXA1 and NF-κB Signal Transduction Via the Induction of MiR-132-3p[34523052] |
Mol Med Rep | Emodin inhibits the progression of acute pancreatitis via regulation of lncRNA TUG1 and exosomal lncRNA TUG1[34498715] |
Int Immunopharmacol | Pravastatin attenuates sepsis-induced acute lung injury through decreasing pulmonary microvascular permeability via inhibition of Cav-1/eNOS pathway[34464887] |
JOURNAL OF PHARMACY AND PHARMACOLOGY | Potential therapeutic efficacy of pachymic acid in chronic kidney disease induced in rats: role of Wnt/β-catenin/renin–angiotensin axis[34549301] |
ECOTOXICOLOGY AND ENVIRONMENTAL SAFETY | Chronic developmental exposure to low-dose ([C8mim][PF6]) induces neurotoxicity and behavioural abnormalities in rats[34555716] |
BIOMEDICINE & PHARMACOTHERAPY | Ginkgo biloba extract (EGb 761) mitigates methotrexate-induced testicular insult in rats: Targeting oxidative stress, energy deficit and spermatogenesis[34560547] |
Cell Metabolism | Pharmacological inhibition of arachidonate 12-lipoxygenase ameliorates myocardial ischemia-reperfusion injury in multiple species[34536344] |
Food Chem Toxicol | Anti-inflammatory action of betulin and its potential as a dissociated glucocorticoid receptor modulator[34500009] |
Neurosci Lett | Flavin-containing monooxygenase 1 deficiency promotes neuroinflammation in dopaminergic neurons in mice[34500002] |
Int J Biochem Cell Biol | Impact of Type 2 Diabetes Mellitus on the Immunoregulatory Characteristics of Adipose Tissue-Derived Mesenchymal Stem Cells[34455058] |
Int Immunopharmacol | Diacerein ameliorates testosterone-induced benign prostatic hyperplasia in rats: Effect on oxidative stress, inflammation and apoptosis[34450401] |
Biochim Biophys Acta Mol Cell Biol Lipids | Elaidic acid induced NLRP3 inflammasome activation via ERS-MAPK signaling pathways in Kupffer cells[34610469] |
CNS Neurosci Ther | Alterations in the gut microbiome with hemorrhagic transformation in experimental stroke[34591349] |
Med Pharm Rep | Effects of the Sonchus Arvensis Fraction in Rats with Monosodium Urate–Induced Gouty Arthritis[34430859] |
J Periodontol | Cytokine profile in serum and gingival crevicular fluid of children with inflammatory bowel disease: A case‐control study[34730850] |
J Agric Food Chem | Allicin Ameliorates Intestinal Barrier Damage via Microbiota-Regulated Short-Chain Fatty Acids-TLR4/MyD88/NF-κB Cascade Response in Acrylamide-Induced Rats[34694121] |
Inflammation | The Role of IL-27 in the Systemic Inflammatory Response That Accompanies Preterm Labour[34773188] |
Biofactors | Vitamin D3 enhances the effects of omega‐3 oils against metabolic dysfunction‐associated fatty liver disease in rat[34767670] |
Inflamm Res | Dexmedetomidine exerts cerebral protective effects against cerebral ischemic injury by promoting the polarization of M2 microglia via the Nrf2/HO-1/NLRP3 pathway[34767031] |
J Ethnopharmacol | Bai-Hu-Tang regulates endothelin-1 and its signalling pathway in vascular endothelial cells[34752899] |
Biomaterials | 3D-bioprinted BMSC-laden biomimetic multiphasic scaffolds for efficient repair of osteochondral defects in an osteoarthritic rat model[34739982] |
Korean J Physiol Pharmacol | Improved motility in the gastrointestinal tract of a postoperative ileus rat model with ilaprazole[34697261] |
Neurosci Let | Fingolimod protects against cerebral ischemia reperfusion injury in rats by reducing inflammatory cytokines and inhibiting the activation of p38 MAPK and NF-κB?…[34942319] |
Animals (Basel) | Inflammatory markers in uterine lavage fluids of pregnant, non-pregnant, and intrauterine device implanted mares on Days 10 and 15 post ovulation[34944269] |
Alzheimers Res Ther | Intermittent hypoxia treatment alleviates memory impairment in the 6-month-old APPswe/PS1dE9 mice and reduces amyloid beta accumulation and?…[34844651] |
World J Gastroenterol | Calycosin attenuates severe acute pancreatitis-associated acute lung injury by curtailing high mobility group box 1-induced inflammation[34908806] |
Experimental and Therapeutic Medicine | Autonomic regulation of imbalance?induced myocardial fibrosis and its mechanism in rats with cirrhosis[34373726] |
Food Science & Technology | Lactobacillus casei relieves liver injury by regulating immunity and suppression of the enterogenic endotoxin‐induced inflammatory response in rats cotreated with?…[34646510] |
Pharmaceutics | Nitric-Oxide-Releasing Dexamethasone Derivative NCX-1005 Improves Lung Function and Attenuates Inflammation in Experimental Lavage-Induced ARDS[34959373] |
Viruses | Interleukin-10-Mediated Lymphopenia Caused by Acute Infection with Foot-and-Mouth Disease Virus in Mice[34960627] |
Eur J Pharm Sci | Preclinical study of methotrexate-based hydrogels versus surfactant based liquid crystal systems on psoriasis treatment[34314841] |
Toxicology | Salidroside alleviates liver inflammation in furan-induced mice by regulating oxidative stress and endoplasmic reticulum stress[34450210] |
Animal Nutrition | Optimizing the growth and immune system of dairy calves by subdividing the pre-weaning period and providing different milk volumes for each stage[34786502] |
Antioxidants | Key Mechanisms and Potential Implications of Hericium erinaceus in NLRP3 Inflammasome Activation by Reactive Oxygen Species during Alzheimer's Disease[34829535] |
Mol Med Rep | Long non-coding RNA NEAT1 participates in ventilator-induced lung injury by regulating miR-20b expression[Pubmed:34981816] |
Anesthesiology | Adverse Mechanical Ventilation and Pneumococcal Pneumonia Induce Immune and Mitochondrial Dysfunctions Mitigated by Mesenchymal Stem Cells in Rabbits[Pubmed:34965287] |
J Mol Neurosci | TRPV1 Suppressed NLRP3 Through Regulating Autophagy in Microglia After Ischemia-Reperfusion Injury[Pubmed:35041191] |
J Inflamm Res | Clenbuterol, a Selective β2-Adrenergic Receptor Agonist, Inhibits or Limits Post-Stroke Pneumonia, but Increases Infarct Volume in MCAO Mice[Pubmed:35058704] |
Int J Nanomedicine | Protective Effects of Carbon Dots Derived from Armeniacae Semen Amarum Carbonisata Against Acute Lung Injury Induced by Lipopolysaccharides in Rats[Pubmed:35023915] |
Poult Sci | Hypervirulent FAdV-4 infection induces activation of the NLRP3 inflammasome in chicken macrophages[Pubmed:35077922] |
Animals (Basel) | Inflammatory Markers in Uterine Lavage Fluids of Pregnant, Non-Pregnant, and Intrauterine Device Implanted Mares on Days 10 and 15 Post Ovulation?…[Pubmed:34944269] |
Bioengineered | Inflammation promotes erythropoietin induced vascular calcification by activating p38 pathway[Pubmed:35168476] |
J Biochem Mol Toxicol | Silencing of IGF2BP1 restrains ox‐LDL‐induced lipid accumulation and inflammation by reducing RUNX1 expression and promoting autophagy in macrophages[Pubmed:35179253] |
Toxicology | NaF-induced neurotoxicity via activation of the IL-1β/JNK signaling pathway[Pubmed:35172196] |
Ecotoxicol Environ Saf | Silica nanoparticles induce pulmonary autophagy dysfunction and epithelial-to-mesenchymal transition via p62/NF-κB signaling pathway[Pubmed:35158278] |
FASEB J | proBDNF/p75NTR promotes rheumatoid arthritis and inflammatory response by activating proinflammatory cytokines[Pubmed:35129860] |
Cell Death Discov | Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury[Pubmed:35110526] |
Chin Med | Red yeast rice ameliorates non-alcoholic fatty liver disease through inhibiting lipid synthesis and NF-κB/NLRP3 inflammasome-mediated hepatic inflammation?…[Pubmed:35078487] |
J Dairy Sci | Intake of Bifidobacterium lactis Probio-M8 fermented milk protects against alcoholic liver disease[Pubmed:35086715] |
Exp Biol Med (Maywood) | Protective antioxidative and anti-inflammatory actions of β-caryophyllene against sulfasalazine-induced nephrotoxicity in rat[Pubmed:35068213] |
Peptides | Osteocrin alleviates cardiac hypertrophy via attenuating oxidative stress[Pubmed:35218795] |
Int Immunopharmacol | LncRNA KCNQ1OT1 attenuates myocardial injury induced by hip fracture via regulating of miR-224-3p/GATA4 axis[Pubmed:35217336] |
Antioxidants (Basel) | Vitamin K2 (Menaquinone-7) Reverses Age-Related Structural and Cognitive Deterioration in Naturally Aging Rats[Pubmed:35326164] |
PLoS One | Investigation of the active ingredients and pharmacological mechanisms of Porana sinensis Hemsl. Against rheumatoid arthritis using network pharmacology?…[Pubmed:35235611] |
Free Radic Biol Med | Silica nanoparticles induce pyroptosis and cardiac hypertrophy via ROS/NLRP3/Caspase-1 pathway[Pubmed:35219847] |
Molecular Biotechnology | MiR-199a-3p Restrains Foaming and Inflammation by Regulating RUNX1 in Macrophages[Pubmed:35435591] |
International Heart Journal | Melatonin Inhibits OGD/R-Induced H9c2 Cardiomyocyte Pyroptosis via Regulation of MT2/miR-155/FOXO3a/ARC Axis[Pubmed:35354753] |
Journal of Integrative Neuroscience | Gastrodin suppresses pyroptosis and exerts neuroprotective effect in traumatic brain injury model by inhibiting NLRP3 inflammasome signaling pathway[Pubmed:35364660] |
Neurochem Res | Effects of Ethanolic Extract of Cynara cardunculus (Artichoke) Leaves on Neuroinflammatory and Neurochemical Parameters in a Diet-Induced Mice Obesity Model[Pubmed:35426598] |
Inflammopharmacology | Silymarin constrains diacetyl-prompted oxidative stress and neuroinflammation in rats: involvements of Dyn/GDNF and MAPK signaling pathway[Pubmed:35366745] |
Evid Based Complement Alternat Med | Loureirin B Alleviates Myocardial Ischemia/Reperfusion Injury via Inhibiting PAI-1/TGF-β1/Smad Signaling Pathway[Pubmed:35535157] |
Perfusion | Insulin reduces pyroptosis-induced inflammation by PDHA1 dephosphorylation-mediated NLRP3 activation during myocardial ischemia-reperfusion injury[Pubmed:35506656] |
Eur J Pharmacol | Potential cardioprotective effect of octreotide via NOXs mitigation, mitochondrial biogenesis and MAPK/Erk1/2/STAT3/NF-kβ pathway attenuation in isoproterenol?…[Pubmed:35500641] |
J Clin Med | Endometrial Dysbiosis Is Related to Inflammatory Factors in Women with Repeated Implantation Failure: A Pilot Study[Pubmed:35566605] |
Expert Opinion on Therapeutic Targets | Dapagliflozin mitigates ovalbumin-prompted airway inflammatory-oxidative successions and associated bronchospasm in a rat model of allergic asthma[Pubmed:35549595] |
American Journal of Translational Research | Curcumin treats endometriosis in mice by the HIF signaling pathway[Pubmed:35559378] |
Mol Immunol | Oridonin alleviates kanamycin-related hearing loss by inhibiting NLRP3/caspase-1/gasdermin D-induced inflammasome activation and hair cell pyroptosis[Pubmed:35749835] |
J Biomed Mater Res B Appl Biomater | Hybrid system with stable structure of hard/soft tissue substitutes induces re‐osseointegration in a rat model of biofilm‐mediated peri‐implantitis[Pubmed:35620882] |
Ecotoxicol Environ Saf | Ambient ozone exposure induces ROS related-mitophagy and pyroptosis via NLRP3 inflammasome activation in rat lung cells[Pubmed:35642860] |
Evaluation of Tubular Dysfunction Using Urine Biomarkers in Children with COVID-19[Pubmed:35110086] | |
Poultry Science | Modulation of the innate immune system by lipopolysaccharide in the proventriculus of chicks inoculated with or without Newcastle disease and infectious?…[Pubmed:35247652] |
Antioxidants | Bio-Evaluation of the Wound Healing Activity of Artemisia judaica L. as Part of the Plant's Use in Traditional Medicine; Phytochemical, Antioxidant, Anti-Inflammatory?…[Pubmed:35204215] |
Antioxidants | Therapeutic Effects of Bee Bread on Obesity-Induced Testicular-Derived Oxidative Stress, Inflammation, and Apoptosis in High-Fat Diet Obese Rat Model?…[Pubmed:35204140] |
Oxidative Medicine and Cellular Longevity | The Role of Aeromonas-Goblet Cell Interactions in Melatonin-Mediated Improvements in Sleep Deprivation-Induced Colitis[Pubmed:35355860] |
Oxidative Medicine and Cellular Longevity | Rhein Ameliorates Cognitive Impairment in an APP/PS1 Transgenic Mouse Model of Alzheimer's Disease by Relieving Oxidative Stress through Activating the?…[Pubmed:35360200] |
Veterinary World | Pro-inflammatory cytokine release from chicken peripheral blood mononuclear cells stimulated with lipopolysaccharide[Pubmed:35698506] |
Glycation renders alpha-synuclein oligomeric strain and modulates microglia activation[] | |
Pyroptosis Accelerates Spiral Ganglion Neuronal Degeneration Induced by Aminoglycosides in the Cochlea[] | |
researchsquare | Dexmedetomidine Attenuates Hyperalgesia Induced By Brachial Plexus Root Avulsion By Restoring The GLT-1 Function Via PKA Signaling[] |